CottonGen offers BLAST with genome, transcriptome, peptide and marker sequence databases from Gossypium species. This can be done using nucleotide sequences or peptide sequences. BLAST functionality is similar to that on NCBI. BLAST Programs: blastn: Search a nucleotide database using a nucleotide query. blastx: Search protein database using a translated nucleotide query. tblastn: Search translated nucleotide database using a protein query. blastp: Search protein database using a protein query. Resources in this dataset:Resource Title: Website Pointer for CottonGen BLAST Search. File Name: Web Page, url: https://www.cottongen.org/blast CottonGen offers BLAST with genome, transcriptome, peptide and marker sequence databases from Gossypium species. This can be done using nucleotide sequences or peptide sequences. BLAST functionality is similar to that on NCBI. Enter or upload FASTA sequence(s) to query and select BLAST database. BLAST Programs: blastn: Search a nucleotide database using a nucleotide query. blastx: Search protein database using a translated nucleotide query. tblastn: Search translated nucleotide database using a protein query. blastp: Search protein database using a protein query.

rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.

Primer Name: MiFish Universal Gene: 12S Length of Target: 163–185 get_seeds_local() minimum length: 170 get_seeds_local() maximum length: 250 blast_seeds() minimum length: 140 blast_seeds() maximum length: 250 max_to_blast: 1000 Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

The goals of Antibiotic Resistance Genes Database (ARGB) are to provide a centralized compendium of information on antibiotic resistance, to facilitate the consistent annotation of resistance information in newly sequenced organisms, and also to facilitate the identification and characterization of new genes. ARGB contains six types of database groups: - Resistance Type: This database contains information, such as resistance profile, mechanism, requirement, epidemiology for each type. - Resistance Gene: This database contains information, such as resistance profile, resistance type, requirement, protein and DNA sequence for each gene.This database only includes NON-REDUNDANT, NON-VECTOR, COMPLETE genes. - Antibiotic: This database contains information, such as producer, action mechanism, resistance type, for each gene. - Resistance Gene(NonRD): This database contains the same information as Resistance Gene. It does NOT include NON-REDUNDANT, NON-VECTOR genes, but includes INCOMPLETE genes. - Resistance Gene(ALL): This database contains the same information as Resistance Gene. It includes all REDUNDANT, VECTOR AND INCOMPLETE genes. - Resistance Species: This database contains resistance profile and corresponding resistance genes for each species. Furthermore, ARDB also contians three types BLAST database: - Resistance Genes Complete: Contains only NON-REDUNDANT, NON-VECTOR, COMPLETE genes sequences. - Resistance Genes Non-redundant: Contains NON-REDUNDANT, NON-VECTOR, COMPLETE, INCOMPLETE genes sequences. - Resistance Genes All: Contains all REDUNDANT, VECTOR, COMPLETE, INCOMPLETE genes sequences. Lastly, ARDB provides four types of Analytical tools: - Normal BLAST: This function allows an user to input a DNA or protein sequence, and find similar DNA (Nucleotide BLAST) or protein (Protein BLAST) sequences using blastn, blastp, blastx, tblastn, tblastx - RPS BLAST: A web RPSBLAST (RPS BLAST) interface is provided to align a query sequence against the Position Specific Scoring Matrix (PSSM) for each type. Normally, this will give the same annotation information as using regular BLAST mentioned above. - Multiple Sequences BLAST (Genome Annotation): This function allows an user to annotate multiple (less than 5000) query sequences in FASTA format. - Mutation Resistance Identification: This function allows an user to identify mutations that will cause potential antibiotic resistance, for 12 genes (16S rRNA, 23S rRNA, gyrA, gyrB, parC, parE, rpoB, katG, pncA, embB, folP, dfr). ������ :Sponsors: ARDB is funded by Uniformed Services University of the Health Sciences, administered by the Henry Jackson Foundation. :

Statistics for each OTU from each replicate provided. For each OTU the number of reads per replicate is shown, as well as the GenBank accession number and further associated information of the closest hit in NCBI. Full taxonomic information is provided only for OTUs with sequence similarities >97% and e-values >e-50 to the respective closest hit, for sequence similarities between 85–97% and e-values between e-20 and e-50 only the respective higher taxonomic categories are provided and all others were assigned to “unknown Metazoa”. (XLSX)

ExonSurfer (https://github.com/CrisRu95/ExonSurfer) BLAST databases. BLAST DBs for human, mouse and rat mRNA with table matching ensembl ID to gene symbol, and BLAST DBs for the genomic DNA. Ensembl transcript database for human was enriched with refseq protein coding transcripts.

CottonGen (https://www.cottongen.org) is a curated and integrated web-based relational database providing access to publicly available genomic, genetic and breeding data to enable basic, translational and applied research in cotton. Built using the open-source Tripal database infrastructure, CottonGen supersedes CottonDB and the Cotton Marker Database, which includes sequences, genetic and physical maps, genotypic and phenotypic markers and polymorphisms, quantitative trait loci (QTLs), pathogens, germplasm collections and trait evaluations, pedigrees, and relevant bibliographic citations, with enhanced tools for easier data sharing, mining, visualization, and data retrieval of cotton research data. CottonGen contains annotated whole genome sequences, unigenes from expressed sequence tags (ESTs), markers, trait loci, genetic maps, genes, taxonomy, germplasm, publications and communication resources for the cotton community. Annotated whole genome sequences of Gossypium raimondii are available with aligned genetic markers and transcripts. These whole genome data can be accessed through genome pages, search tools and GBrowse, a popular genome browser. Most of the published cotton genetic maps can be viewed and compared using CMap, a comparative map viewer, and are searchable via map search tools. Search tools also exist for markers, quantitative trait loci (QTLs), germplasm, publications and trait evaluation data. CottonGen also provides online analysis tools such as NCBI BLAST and Batch BLAST. This project is funded/supported by Cotton Incorporated, the USDA-ARS Crop Germplasm Research Unit at College Station, TX, the Southern Association of Agricultural Experiment Station Directors, Bayer CropScience, Corteva/Agriscience, Dow/Phytogen, Monsanto, Washington State University, and NRSP10. Resources in this dataset:Resource Title: Website Pointer for CottonGen. File Name: Web Page, url: https://www.cottongen.org/ Genomic, Genetic and Breeding Resources for Cotton Research Discovery and Crop Improvement organized by :

Species (Gossypium arboreum, barbadense, herbaceum, hirsutum, raimondii, others), Data (Contributors, Download, Submission, Community Projects, Archives, Cotton Trait Ontology, Nomenclatures, and links to Variety Testing Data and NCBISRA Datasets), Search options (Colleague, Genes and Transcripts, Genotype, Germplasm, Map, Markers, Publications, QTLs, Sequences, Trait Evaluation, MegaSearch), Tools (BIMS, BLAST+, CottonCyc, JBrowse, Map Viewer, Primer3, Sequence Retrieval, Synteny Viewer), International Cotton Genome Initiative (ICGI), and Help sources (User manual, FAQs).

Also provides Quick Start links for Major Species and Tools.

BIMS, the Breeding Information Management System, is a secure and comprehensive online breeding management system developed for the generic Tripal Database Platform which allows breeders to store, manage, archive and analyze their private breeding program. Breeders can load data in templates provided as well as output from the Field Book App, an android app for collecting phenotype data. In addition to the private breeders BIMS, users without accounts can also view the publicly available breeding data. The fully developed version will allow users to:

Fully integrate their data with publicly available genomic, genetic and breeding data in the community database.

Utilize their integrated pedigree, phenotype and genotype data in performing genomic analysis and making breeding decisions.

Use open-source new genomics tool and breeding decision tools with seamless access to HPC. Resources in this dataset:Resource Title: Website Pointer for CottonGen BIMS (Breeding Information Management System). File Name: Web Page, url: https://www.cottongen.org/bims BIMS, the Breeding Information Management System, is a secure and comprehensive online breeding management system developed for the generic Tripal Database Platform which allows breeders to store, manage, archive and analyze their private breeding program. Breeders can load data in templates provided as well as output from the Field Book App, an android app for collecting phenotype data. In addition to the private breeders BIMS users without accounts can also view the publicly available breeding data. The fully developed version will allow users to:

Fully integrate their data with publicly available genomic, genetic and breeding data in the community database

Utilize their integrated pedigree, phenotype and genotype data in performing genomic analysis and making breeding decisions.

Use open-source new genomics tool and breeding decision tools with seamless access to HPC.

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name: MiDeca Gene: 16S Length of Target: 154-184 get_seeds_local() minimum length: 105 get_seeds_local() maximum length: 230 blast_seeds() minimum length: 66 blast_seeds() maximum length: 191 max_to_blast: 50 Forward Sequence (5'-3'): GGACGATAAGACCCTATAAA Reverse Sequence (5'-3'): ACGCTGTTATCCCTAAAGT Reference: Komai, T., Gotoh, R.O., Sado, T. and Miya, M., 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. Metabarcoding and Metagenomics, 3, p.e33835. https://doi.org/10.3897/mbmg.6.76534

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name: MiSebastes Gene: CytB Length of Target: 153 get_seeds_local() minimum length: 107 get_seeds_local() maximum length: 199 blast_seeds() minimum length: 71 blast_seeds() maximum length: 163 max_to_blast: 100 Forward Sequence (5'-3'): AAGCTCATTCAAGTGCTT Reverse Sequence (5'-3'): GACCACTTACACAATTCT Reference: Min, M. A., Barber, P. H., & Gold, Z. (2021). MiSebastes: An eDNA metabarcoding primer set for rockfishes (genus Sebastes). Conservation Genetics Resources, 13(4), 447-456. https://doi.org/10.1007/s12686-021-01219-2

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

THIS RESOURCE IS NO LONGER IN SERVICE, documented August 22, 2016. A database of information on bacterial phages. It contains multiple phage genomes, which users can BLAST and MegaBLAST, and also hosts a Phage Forum in which users can discuss phage data. Interactive browsing of completed phage genomes is available using the program. The browser allows users to scan the genome for particular features and to download sequence information plus analyses of those features. Views of the genome are generated showing named genes BLAST similarities to other phages predicted tRNAs and other sequence features.

DRLZ compression and indexing of bacterial pan-genomes with BLAST.

For samples from the Elbe estuary, the tide during sampling as well as the closest high (HT) or low (LT) tide event is provided. (XLSX)

1Statistically significant protein spot identification after MALDI-TOF MS analysis followed by PMF search of the H. contortus putative EST protein database.2Non-statistically significant protein spot identification after MALDI-TOF MS analysis followed by PMF search of the H. contortus putative EST protein database, but verified by statistically significant protein spot identification after Q-TOF MS/MS analysis.3Statistically significant protein spot identification after MALDI-TOF MS analysis followed by PMF search of the H. contortus putative EST protein database. These results were confirmed by Q-TOF MS/MS analysis.4Statistically significant protein spot identification after Q-TOF MS/MS followed by BLASTp search of the H. contortus putative EST protein database.5Non-statistically significant protein spot identification after MALDI-TOF MS analysis followed by PMF search of the H. contortus putative EST protein database. However, the observed Mw of the spots, calculated on the gel image, were correlated with the theoretical Mw of the intact protein in the best BLASTp match. These data are detailed in Tables S3 & S4.Each protein spot was excised from the 250 µg protein-loaded gel and analysed by MALDI-TOF MS. A local MASCOT PMF search of the H. contortus putative EST protein database was performed and the highest scoring EST sequence match, along with its MOWSE-based score (significance threshold score >51, p-value25, p-value44, p-value

Preserving biodiversity is a global challenge requiring data on species’ distribution and abundance over large geographic and temporal scales. However, traditional methods to survey mobile species’ distribution and abundance in marine environments are often inefficient, environmentally destructive, or resource-intensive. Metabarcoding of environmental DNA (eDNA) offers a new means to assess biodiversity and on much larger scales, but adoption of this approach for surveying whole animal communities in large, dynamic aquatic systems has been slowed by significant unknowns surrounding error rates of detection and relevant spatial resolution of eDNA surveys. Here, we report the results of a 2.5 km eDNA transect surveying the vertebrate fauna present along a gradation of diverse marine habitats associated with a kelp forest ecosystem. Using PCR primers that target the mitochondrial 12S rRNA gene of marine fishes and mammals, we generated eDNA sequence data and compared it to simultaneous vis...

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name: rbcl (Plant RBCL7/8)
Gene: rbcl
Length of Target: 180
get_seeds_local() minimum length: 170
get_seeds_local() maximum length: 250
blast_seeds() minimum length: 140
blast_seeds() maximum length: 150
max_to_blast: 100
Forward Sequence (5'-3'): CTCCTGAMTAYGAAACCAAAGA
Reverse Sequence (5'-3'): GTAGCAGCGCCCTTTGTAAC
Reference: McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

This dataset contains faa and gff files originating from RefSeq Betaproteobacteria complete sequence database available on 2020 Sept 5. Files ending with .phr, .pin, and .psq are blast database.

Compressing human pan-genomes using reference sequence size of 30%.

Additional file 10. Results of the blast search conducted for WSSV genes against the blast database of shrimp/human genes and Chinese mitten crab genome to find the homologous genes.

Geographic origins are listed verbatim from the archive specimen labels.

This database presents a PartiGene analysis of the Bombus terrestris worker caste normalised Sanger ESTs produced by Sadd et al.