21 datasets found
  1. N

    Cardiff, AL Age Group Population Dataset: A Complete Breakdown of Cardiff...

    • neilsberg.com
    csv, json
    Updated Feb 22, 2025
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Neilsberg Research (2025). Cardiff, AL Age Group Population Dataset: A Complete Breakdown of Cardiff Age Demographics from 0 to 85 Years and Over, Distributed Across 18 Age Groups // 2025 Edition [Dataset]. https://www.neilsberg.com/research/datasets/451613f2-f122-11ef-8c1b-3860777c1fe6/
    Explore at:
    csv, jsonAvailable download formats
    Dataset updated
    Feb 22, 2025
    Dataset authored and provided by
    Neilsberg Research
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Cardiff, Alabama
    Variables measured
    Population Under 5 Years, Population over 85 years, Population Between 5 and 9 years, Population Between 10 and 14 years, Population Between 15 and 19 years, Population Between 20 and 24 years, Population Between 25 and 29 years, Population Between 30 and 34 years, Population Between 35 and 39 years, Population Between 40 and 44 years, and 9 more
    Measurement technique
    The data presented in this dataset is derived from the latest U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates. To measure the two variables, namely (a) population and (b) population as a percentage of the total population, we initially analyzed and categorized the data for each of the age groups. For age groups we divided it into roughly a 5 year bucket for ages between 0 and 85. For over 85, we aggregated data into a single group for all ages. For further information regarding these estimates, please feel free to reach out to us via email at research@neilsberg.com.
    Dataset funded by
    Neilsberg Research
    Description
    About this dataset

    Context

    The dataset tabulates the Cardiff population distribution across 18 age groups. It lists the population in each age group along with the percentage population relative of the total population for Cardiff. The dataset can be utilized to understand the population distribution of Cardiff by age. For example, using this dataset, we can identify the largest age group in Cardiff.

    Key observations

    The largest age group in Cardiff, AL was for the group of age 40 to 44 years years with a population of 14 (33.33%), according to the ACS 2019-2023 5-Year Estimates. At the same time, the smallest age group in Cardiff, AL was the Under 5 years years with a population of 0 (0%). Source: U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates

    Content

    When available, the data consists of estimates from the U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates

    Age groups:

    • Under 5 years
    • 5 to 9 years
    • 10 to 14 years
    • 15 to 19 years
    • 20 to 24 years
    • 25 to 29 years
    • 30 to 34 years
    • 35 to 39 years
    • 40 to 44 years
    • 45 to 49 years
    • 50 to 54 years
    • 55 to 59 years
    • 60 to 64 years
    • 65 to 69 years
    • 70 to 74 years
    • 75 to 79 years
    • 80 to 84 years
    • 85 years and over

    Variables / Data Columns

    • Age Group: This column displays the age group in consideration
    • Population: The population for the specific age group in the Cardiff is shown in this column.
    • % of Total Population: This column displays the population of each age group as a proportion of Cardiff total population. Please note that the sum of all percentages may not equal one due to rounding of values.

    Good to know

    Margin of Error

    Data in the dataset are based on the estimates and are subject to sampling variability and thus a margin of error. Neilsberg Research recommends using caution when presening these estimates in your research.

    Custom data

    If you do need custom data for any of your research project, report or presentation, you can contact our research staff at research@neilsberg.com for a feasibility of a custom tabulation on a fee-for-service basis.

    Inspiration

    Neilsberg Research Team curates, analyze and publishes demographics and economic data from a variety of public and proprietary sources, each of which often includes multiple surveys and programs. The large majority of Neilsberg Research aggregated datasets and insights is made available for free download at https://www.neilsberg.com/research/.

    Recommended for further research

    This dataset is a part of the main dataset for Cardiff Population by Age. You can refer the same here

  2. Population of Wales 2023, by unitary authority

    • statista.com
    Updated Jan 9, 2025
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Statista (2025). Population of Wales 2023, by unitary authority [Dataset]. https://www.statista.com/statistics/971295/regional-population-wales/
    Explore at:
    Dataset updated
    Jan 9, 2025
    Dataset authored and provided by
    Statistahttp://statista.com/
    Time period covered
    2023
    Area covered
    Wales
    Description

    The population of Wales in 2023 was just approximately 3.16 million, and was quite heavily concentrated on the south coast of the country, especially in the large cities of Cardiff and Swansea where approximately 383,500 and 246,700 people live, respectively.

  3. N

    Cardiff, AL Age Cohorts Dataset: Children, Working Adults, and Seniors in...

    • neilsberg.com
    csv, json
    Updated Feb 22, 2025
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Neilsberg Research (2025). Cardiff, AL Age Cohorts Dataset: Children, Working Adults, and Seniors in Cardiff - Population and Percentage Analysis // 2025 Edition [Dataset]. https://www.neilsberg.com/research/datasets/4b73e1d0-f122-11ef-8c1b-3860777c1fe6/
    Explore at:
    csv, jsonAvailable download formats
    Dataset updated
    Feb 22, 2025
    Dataset authored and provided by
    Neilsberg Research
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Cardiff, Alabama
    Variables measured
    Population Over 65 Years, Population Under 18 Years, Population Between 18 and 64 Years, Percent of Total Population for Age Groups
    Measurement technique
    The data presented in this dataset is derived from the latest U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates. To measure the two variables, namely (a) population and (b) population as a percentage of the total population, we initially analyzed and categorized the data for each of the age cohorts. For age cohorts we divided it into three buckets Children ( Under the age of 18 years), working population ( Between 18 and 64 years) and senior population ( Over 65 years). For further information regarding these estimates, please feel free to reach out to us via email at research@neilsberg.com.
    Dataset funded by
    Neilsberg Research
    Description
    About this dataset

    Context

    The dataset tabulates the Cardiff population by age cohorts (Children: Under 18 years; Working population: 18-64 years; Senior population: 65 years or more). It lists the population in each age cohort group along with its percentage relative to the total population of Cardiff. The dataset can be utilized to understand the population distribution across children, working population and senior population for dependency ratio, housing requirements, ageing, migration patterns etc.

    Key observations

    The largest age group was 18 to 64 years with a poulation of 34 (80.95% of the total population). Source: U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates.

    Content

    When available, the data consists of estimates from the U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates.

    Age cohorts:

    • Under 18 years
    • 18 to 64 years
    • 65 years and over

    Variables / Data Columns

    • Age Group: This column displays the age cohort for the Cardiff population analysis. Total expected values are 3 groups ( Children, Working Population and Senior Population).
    • Population: The population for the age cohort in Cardiff is shown in the following column.
    • Percent of Total Population: The population as a percent of total population of the Cardiff is shown in the following column.

    Good to know

    Margin of Error

    Data in the dataset are based on the estimates and are subject to sampling variability and thus a margin of error. Neilsberg Research recommends using caution when presening these estimates in your research.

    Custom data

    If you do need custom data for any of your research project, report or presentation, you can contact our research staff at research@neilsberg.com for a feasibility of a custom tabulation on a fee-for-service basis.

    Inspiration

    Neilsberg Research Team curates, analyze and publishes demographics and economic data from a variety of public and proprietary sources, each of which often includes multiple surveys and programs. The large majority of Neilsberg Research aggregated datasets and insights is made available for free download at https://www.neilsberg.com/research/.

    Recommended for further research

    This dataset is a part of the main dataset for Cardiff Population by Age. You can refer the same here

  4. g

    Local Labour Force Survey/Annual Population Survey: Ethnicity by Welsh local...

    • statswales.gov.wales
    Updated Nov 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    (2023). Local Labour Force Survey/Annual Population Survey: Ethnicity by Welsh local authority [Dataset]. https://statswales.gov.wales/Catalogue/Equality-and-Diversity/Ethnicity/ethnicity-by-area-ethnicgroup
    Explore at:
    Dataset updated
    Nov 2023
    Area covered
    Wales
    Description

    This dataset provides information on the ethnicity of people by Welsh local authority.

  5. N

    Cardiff, AL Non-Hispanic Population Breakdown By Race Dataset: Non-Hispanic...

    • neilsberg.com
    csv, json
    Updated Feb 21, 2025
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Neilsberg Research (2025). Cardiff, AL Non-Hispanic Population Breakdown By Race Dataset: Non-Hispanic Population Counts and Percentages for 7 Racial Categories as Identified by the US Census Bureau // 2025 Edition [Dataset]. https://www.neilsberg.com/research/datasets/99d373bc-ef82-11ef-9e71-3860777c1fe6/
    Explore at:
    json, csvAvailable download formats
    Dataset updated
    Feb 21, 2025
    Dataset authored and provided by
    Neilsberg Research
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Cardiff, Alabama
    Variables measured
    Non-Hispanic Asian Population, Non-Hispanic Black Population, Non-Hispanic White Population, Non-Hispanic Some other race Population, Non-Hispanic Two or more races Population, Non-Hispanic American Indian and Alaska Native Population, Non-Hispanic Native Hawaiian and Other Pacific Islander Population, Non-Hispanic Asian Population as Percent of Total Non-Hispanic Population, Non-Hispanic Black Population as Percent of Total Non-Hispanic Population, Non-Hispanic White Population as Percent of Total Non-Hispanic Population, and 4 more
    Measurement technique
    The data presented in this dataset is derived from the latest U.S. Census Bureau American Community Survey (ACS) 2017-2021 5-Year Estimates. To measure the two variables, namely (a) Non-Hispanic population and (b) population as a percentage of the total Non-Hispanic population, we initially analyzed and categorized the data for each of the racial categories idetified by the US Census Bureau. It is ensured that the population estimates used in this dataset pertain exclusively to the identified racial categories, and are part of Non-Hispanic classification. For further information regarding these estimates, please feel free to reach out to us via email at research@neilsberg.com.
    Dataset funded by
    Neilsberg Research
    Description
    About this dataset

    Context

    The dataset tabulates the Non-Hispanic population of Cardiff by race. It includes the distribution of the Non-Hispanic population of Cardiff across various race categories as identified by the Census Bureau. The dataset can be utilized to understand the Non-Hispanic population distribution of Cardiff across relevant racial categories.

    Key observations

    With a zero Hispanic population, Cardiff is 100% Non-Hispanic. Among the Non-Hispanic population, the largest racial group is White alone with a population of 42 (100% of the total Non-Hispanic population).

    Content

    When available, the data consists of estimates from the U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates.

    Racial categories include:

    • White
    • Black or African American
    • American Indian and Alaska Native
    • Asian
    • Native Hawaiian and Other Pacific Islander
    • Some other race
    • Two or more races (multiracial)

    Variables / Data Columns

    • Race: This column displays the racial categories (for Non-Hispanic) for the Cardiff
    • Population: The population of the racial category (for Non-Hispanic) in the Cardiff is shown in this column.
    • % of Total Population: This column displays the percentage distribution of each race as a proportion of Cardiff total Non-Hispanic population. Please note that the sum of all percentages may not equal one due to rounding of values.

    Good to know

    Margin of Error

    Data in the dataset are based on the estimates and are subject to sampling variability and thus a margin of error. Neilsberg Research recommends using caution when presening these estimates in your research.

    Custom data

    If you do need custom data for any of your research project, report or presentation, you can contact our research staff at research@neilsberg.com for a feasibility of a custom tabulation on a fee-for-service basis.

    Inspiration

    Neilsberg Research Team curates, analyze and publishes demographics and economic data from a variety of public and proprietary sources, each of which often includes multiple surveys and programs. The large majority of Neilsberg Research aggregated datasets and insights is made available for free download at https://www.neilsberg.com/research/.

    Recommended for further research

    This dataset is a part of the main dataset for Cardiff Population by Race & Ethnicity. You can refer the same here

  6. g

    Mid-year population estimates (2009 onwards), by Welsh health boards, by...

    • statswales.gov.wales
    Updated Jul 2024
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    (2024). Mid-year population estimates (2009 onwards), by Welsh health boards, by single year of age and sex [Dataset]. https://statswales.gov.wales/Catalogue/Population-and-Migration/Population/Estimates/Local-Health-Boards/populationestimates-by-lhb-age
    Explore at:
    Dataset updated
    Jul 2024
    Area covered
    Wales
    Description

    This dataset provides population estimates for the local health boards in Wales, for the period from 2009 onwards by sex and single year of age, together with some aggregated age groups. It should be noted that for mid-2020, there are some definitional changes (particularly affecting the migration components) compared with mid-2019 populations estimates data and it is advised users read the Quality and Methodology Information section on the Office for National Statistics website. For Wales, the mid-2021 population estimates are the first population estimates to be based on Census 2021. Internal migration estimates for mid-2023 have been produced using a different method to previous years, following a change to the variables available in the Higher Education Statistics Agency (HESA) data. This material is Crown Copyright and may be re-used (not including logos) free of charge in any format or medium, under the terms of the Open Government Licence.

  7. N

    Cardiff, AL Population Pyramid Dataset: Age Groups, Male and Female...

    • neilsberg.com
    csv, json
    Updated Jul 24, 2024
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Neilsberg Research (2024). Cardiff, AL Population Pyramid Dataset: Age Groups, Male and Female Population, and Total Population for Demographics Analysis // 2024 Edition [Dataset]. https://www.neilsberg.com/research/datasets/f0158efb-4983-11ef-ae5d-3860777c1fe6/
    Explore at:
    json, csvAvailable download formats
    Dataset updated
    Jul 24, 2024
    Dataset authored and provided by
    Neilsberg Research
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Cardiff, Alabama
    Variables measured
    Male and Female Population Under 5 Years, Male and Female Population over 85 years, Male and Female Total Population for Age Groups, Male and Female Population Between 5 and 9 years, Male and Female Population Between 10 and 14 years, Male and Female Population Between 15 and 19 years, Male and Female Population Between 20 and 24 years, Male and Female Population Between 25 and 29 years, Male and Female Population Between 30 and 34 years, Male and Female Population Between 35 and 39 years, and 9 more
    Measurement technique
    The data presented in this dataset is derived from the latest U.S. Census Bureau American Community Survey (ACS) 2018-2022 5-Year Estimates. To measure the three variables, namely (a) male population, (b) female population and (b) total population, we initially analyzed and categorized the data for each of the age groups. For age groups we divided it into roughly a 5 year bucket for ages between 0 and 85. For over 85, we aggregated data into a single group for all ages. For further information regarding these estimates, please feel free to reach out to us via email at research@neilsberg.com.
    Dataset funded by
    Neilsberg Research
    Description
    About this dataset

    Context

    The dataset tabulates the data for the Cardiff, AL population pyramid, which represents the Cardiff population distribution across age and gender, using estimates from the U.S. Census Bureau American Community Survey (ACS) 2018-2022 5-Year Estimates. It lists the male and female population for each age group, along with the total population for those age groups. Higher numbers at the bottom of the table suggest population growth, whereas higher numbers at the top indicate declining birth rates. Furthermore, the dataset can be utilized to understand the youth dependency ratio, old-age dependency ratio, total dependency ratio, and potential support ratio.

    Key observations

    • Youth dependency ratio, which is the number of children aged 0-14 per 100 persons aged 15-64, for Cardiff, AL, is 35.3.
    • Old-age dependency ratio, which is the number of persons aged 65 or over per 100 persons aged 15-64, for Cardiff, AL, is 17.6.
    • Total dependency ratio for Cardiff, AL is 52.9.
    • Potential support ratio, which is the number of youth (working age population) per elderly, for Cardiff, AL is 5.7.
    Content

    When available, the data consists of estimates from the U.S. Census Bureau American Community Survey (ACS) 2018-2022 5-Year Estimates.

    Age groups:

    • Under 5 years
    • 5 to 9 years
    • 10 to 14 years
    • 15 to 19 years
    • 20 to 24 years
    • 25 to 29 years
    • 30 to 34 years
    • 35 to 39 years
    • 40 to 44 years
    • 45 to 49 years
    • 50 to 54 years
    • 55 to 59 years
    • 60 to 64 years
    • 65 to 69 years
    • 70 to 74 years
    • 75 to 79 years
    • 80 to 84 years
    • 85 years and over

    Variables / Data Columns

    • Age Group: This column displays the age group for the Cardiff population analysis. Total expected values are 18 and are define above in the age groups section.
    • Population (Male): The male population in the Cardiff for the selected age group is shown in the following column.
    • Population (Female): The female population in the Cardiff for the selected age group is shown in the following column.
    • Total Population: The total population of the Cardiff for the selected age group is shown in the following column.

    Good to know

    Margin of Error

    Data in the dataset are based on the estimates and are subject to sampling variability and thus a margin of error. Neilsberg Research recommends using caution when presening these estimates in your research.

    Custom data

    If you do need custom data for any of your research project, report or presentation, you can contact our research staff at research@neilsberg.com for a feasibility of a custom tabulation on a fee-for-service basis.

    Inspiration

    Neilsberg Research Team curates, analyze and publishes demographics and economic data from a variety of public and proprietary sources, each of which often includes multiple surveys and programs. The large majority of Neilsberg Research aggregated datasets and insights is made available for free download at https://www.neilsberg.com/research/.

    Recommended for further research

    This dataset is a part of the main dataset for Cardiff Population by Age. You can refer the same here

  8. Data from: Centre for Climate Change and Social Transformations: Cardiff...

    • beta.ukdataservice.ac.uk
    • datacatalogue.cessda.eu
    Updated 2023
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Wouter Poortinga (2023). Centre for Climate Change and Social Transformations: Cardiff Travel Survey, Wave 2, 2022 [Dataset]. http://doi.org/10.5255/ukda-sn-856608
    Explore at:
    Dataset updated
    2023
    Dataset provided by
    DataCitehttps://www.datacite.org/
    UK Data Servicehttps://ukdataservice.ac.uk/
    Authors
    Wouter Poortinga
    Area covered
    Cardiff
    Description

    The Cardiff Travel Survey is a longitudinal survey that aims to (a) establish current and previous (before the coronavirus outbreak) travel habits; (b) explore how travel-related attitudes, social norms and perceptions change over time; and (c) examine the interplay between individual (perceptual) and environmental (infrastructural) factors in travel mode choice, in particular in relation to the uptake of active travel such as walking and cycling in the City of Cardiff, Wales. The Cardiff Travel Survey 2022 (Wave 2) is an opportunity sample that was collected in 2022 (n=968) by the Centre for Climate Change and Social Transformations (CAST), and is the second of a longitudinal series of surveys to be held annually for the duration of the centre. Data for the Cardiff Travel Survey 2022 were collected between 03 May 2022 and 20 July 2022. Participants of the Cardiff Travel Survey 2021 who consented (n=512) were recontacted via email to invite them to take part in the 2022 survey. Furthermore, participants were recruited through posts on social media, such as Facebook® and Twitter®. Invitations were posted on CAST and investigator accounts. The posts on Twitter and Facebook were promoted to make them more visible in the area. The survey was hosted on the Qualtrics online survey platform and available in both English and Welsh. Inclusion criteria were that participants had to be at least 18 years of age and live in or travel regularly to Cardiff. The English version of the survey was completed by 1,034 respondents and the Welsh version by 28 respondents. Incomplete responses (n=95), defined as those without any answers beyond socio-demographic, were removed from the dataset. A further 4 respondents did not complete the first section on current travel behaviours and were also removed. This left a final sample of n=968 adults. Two hundred and ten (210) of these had also responded to the Cardiff Travel Survey 2021. Participants were asked to create a unique code that can be used match this survey to the previous and next surveys without knowing their identity. Main topic areas of the questionnaire are: Demographics, Travel behaviours, Physical activity, Physical health and mental wellbeing, Perceptions of infrastructure and environmental quality, Travel-related social identity, Attitudes to active travel, Social norms, Support for transport policies, and Unique ID.

  9. s

    Output Area Boundaries: Cardiff, Wales, 2001

    • searchworks.stanford.edu
    zip
    Updated May 2, 2021
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    (2021). Output Area Boundaries: Cardiff, Wales, 2001 [Dataset]. https://searchworks.stanford.edu/view/gk279xp2924
    Explore at:
    zipAvailable download formats
    Dataset updated
    May 2, 2021
    Area covered
    Cardiff, Wales
    Description

    This dataset is intended for researchers, students, and policy makers for reference and mapping purposes, and may be used for basic applications such as viewing, querying, and map output production, or to provide a basemap to support graphical overlays and analysis with other spatial data.

  10. Population of England 2023, by county

    • statista.com
    Updated Oct 23, 2024
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Statista (2024). Population of England 2023, by county [Dataset]. https://www.statista.com/statistics/971694/county-population-england/
    Explore at:
    Dataset updated
    Oct 23, 2024
    Dataset authored and provided by
    Statistahttp://statista.com/
    Time period covered
    2023
    Area covered
    England, United Kingdom
    Description

    In 2023, almost nine million people lived in Greater London, making it the most populated ceremonial county in England. The West Midlands Metropolitan County, which contains the large city of Birmingham, was the second-largest county at 2.98 million inhabitants, followed by Greater Manchester and then West Yorkshire with populations of 2.95 million and 2.4 million, respectively. Kent, Essex, and Hampshire were the three next-largest counties in terms of population, each with around 1.89 million people. A patchwork of regions England is just one of the four countries that compose the United Kingdom of Great Britain and Northern Ireland, with England, Scotland and Wales making up Great Britain. England is therefore not to be confused with Great Britain or the United Kingdom as a whole. Within England, the next subdivisions are the nine regions of England, containing various smaller units such as unitary authorities, metropolitan counties and non-metropolitan districts. The counties in this statistic, however, are based on the ceremonial counties of England as defined by the Lieutenancies Act of 1997. Regions of Scotland, Wales, and Northern Ireland Like England, the other countries of the United Kingdom have their own regional subdivisions, although with some different terminology. Scotland’s subdivisions are council areas, while Wales has unitary authorities, and Northern Ireland has local government districts. As of 2022, the most-populated Scottish council area was Glasgow City, with over 622,000 inhabitants. In Wales, Cardiff had the largest population among its unitary authorities, and in Northern Ireland, Belfast was the local government area with the most people living there.

  11. N

    Cardiff, AL Population Breakdown By Race (Excluding Ethnicity) Dataset:...

    • neilsberg.com
    csv, json
    Updated Feb 21, 2025
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Neilsberg Research (2025). Cardiff, AL Population Breakdown By Race (Excluding Ethnicity) Dataset: Population Counts and Percentages for 7 Racial Categories as Identified by the US Census Bureau // 2025 Edition [Dataset]. https://www.neilsberg.com/research/datasets/75650516-ef82-11ef-9e71-3860777c1fe6/
    Explore at:
    json, csvAvailable download formats
    Dataset updated
    Feb 21, 2025
    Dataset authored and provided by
    Neilsberg Research
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Cardiff
    Variables measured
    Asian Population, Black Population, White Population, Some other race Population, Two or more races Population, American Indian and Alaska Native Population, Asian Population as Percent of Total Population, Black Population as Percent of Total Population, White Population as Percent of Total Population, Native Hawaiian and Other Pacific Islander Population, and 4 more
    Measurement technique
    The data presented in this dataset is derived from the latest U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates. To measure the two variables, namely (a) population and (b) population as a percentage of the total population, we initially analyzed and categorized the data for each of the racial categories idetified by the US Census Bureau. It is ensured that the population estimates used in this dataset pertain exclusively to the identified racial categories, and do not rely on any ethnicity classification. For further information regarding these estimates, please feel free to reach out to us via email at research@neilsberg.com.
    Dataset funded by
    Neilsberg Research
    Description
    About this dataset

    Context

    The dataset tabulates the population of Cardiff by race. It includes the population of Cardiff across racial categories (excluding ethnicity) as identified by the Census Bureau. The dataset can be utilized to understand the population distribution of Cardiff across relevant racial categories.

    Key observations

    The percent distribution of Cardiff population by race (across all racial categories recognized by the U.S. Census Bureau): 100% are white.

    Content

    When available, the data consists of estimates from the U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates.

    Racial categories include:

    • White
    • Black or African American
    • American Indian and Alaska Native
    • Asian
    • Native Hawaiian and Other Pacific Islander
    • Some other race
    • Two or more races (multiracial)

    Variables / Data Columns

    • Race: This column displays the racial categories (excluding ethnicity) for the Cardiff
    • Population: The population of the racial category (excluding ethnicity) in the Cardiff is shown in this column.
    • % of Total Population: This column displays the percentage distribution of each race as a proportion of Cardiff total population. Please note that the sum of all percentages may not equal one due to rounding of values.

    Good to know

    Margin of Error

    Data in the dataset are based on the estimates and are subject to sampling variability and thus a margin of error. Neilsberg Research recommends using caution when presening these estimates in your research.

    Custom data

    If you do need custom data for any of your research project, report or presentation, you can contact our research staff at research@neilsberg.com for a feasibility of a custom tabulation on a fee-for-service basis.

    Inspiration

    Neilsberg Research Team curates, analyze and publishes demographics and economic data from a variety of public and proprietary sources, each of which often includes multiple surveys and programs. The large majority of Neilsberg Research aggregated datasets and insights is made available for free download at https://www.neilsberg.com/research/.

    Recommended for further research

    This dataset is a part of the main dataset for Cardiff Population by Race & Ethnicity. You can refer the same here

  12. N

    Cardiff, AL Population Breakdown by Gender and Age Dataset: Male and Female...

    • neilsberg.com
    csv, json
    Updated Feb 24, 2025
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Neilsberg Research (2025). Cardiff, AL Population Breakdown by Gender and Age Dataset: Male and Female Population Distribution Across 18 Age Groups // 2025 Edition [Dataset]. https://www.neilsberg.com/research/datasets/e1d5e132-f25d-11ef-8c1b-3860777c1fe6/
    Explore at:
    json, csvAvailable download formats
    Dataset updated
    Feb 24, 2025
    Dataset authored and provided by
    Neilsberg Research
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Cardiff, Alabama
    Variables measured
    Male and Female Population Under 5 Years, Male and Female Population over 85 years, Male and Female Population Between 5 and 9 years, Male and Female Population Between 10 and 14 years, Male and Female Population Between 15 and 19 years, Male and Female Population Between 20 and 24 years, Male and Female Population Between 25 and 29 years, Male and Female Population Between 30 and 34 years, Male and Female Population Between 35 and 39 years, Male and Female Population Between 40 and 44 years, and 8 more
    Measurement technique
    The data presented in this dataset is derived from the latest U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates. To measure the three variables, namely (a) Population (Male), (b) Population (Female), and (c) Gender Ratio (Males per 100 Females), we initially analyzed and categorized the data for each of the gender classifications (biological sex) reported by the US Census Bureau across 18 age groups, ranging from under 5 years to 85 years and above. These age groups are described above in the variables section. For further information regarding these estimates, please feel free to reach out to us via email at research@neilsberg.com.
    Dataset funded by
    Neilsberg Research
    Description
    About this dataset

    Context

    The dataset tabulates the population of Cardiff by gender across 18 age groups. It lists the male and female population in each age group along with the gender ratio for Cardiff. The dataset can be utilized to understand the population distribution of Cardiff by gender and age. For example, using this dataset, we can identify the largest age group for both Men and Women in Cardiff. Additionally, it can be used to see how the gender ratio changes from birth to senior most age group and male to female ratio across each age group for Cardiff.

    Key observations

    Largest age group (population): Male # 40-44 years (8) | Female # 40-44 years (6). Source: U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates.

    Content

    When available, the data consists of estimates from the U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates.

    Age groups:

    • Under 5 years
    • 5 to 9 years
    • 10 to 14 years
    • 15 to 19 years
    • 20 to 24 years
    • 25 to 29 years
    • 30 to 34 years
    • 35 to 39 years
    • 40 to 44 years
    • 45 to 49 years
    • 50 to 54 years
    • 55 to 59 years
    • 60 to 64 years
    • 65 to 69 years
    • 70 to 74 years
    • 75 to 79 years
    • 80 to 84 years
    • 85 years and over

    Scope of gender :

    Please note that American Community Survey asks a question about the respondents current sex, but not about gender, sexual orientation, or sex at birth. The question is intended to capture data for biological sex, not gender. Respondents are supposed to respond with the answer as either of Male or Female. Our research and this dataset mirrors the data reported as Male and Female for gender distribution analysis.

    Variables / Data Columns

    • Age Group: This column displays the age group for the Cardiff population analysis. Total expected values are 18 and are define above in the age groups section.
    • Population (Male): The male population in the Cardiff is shown in the following column.
    • Population (Female): The female population in the Cardiff is shown in the following column.
    • Gender Ratio: Also known as the sex ratio, this column displays the number of males per 100 females in Cardiff for each age group.

    Good to know

    Margin of Error

    Data in the dataset are based on the estimates and are subject to sampling variability and thus a margin of error. Neilsberg Research recommends using caution when presening these estimates in your research.

    Custom data

    If you do need custom data for any of your research project, report or presentation, you can contact our research staff at research@neilsberg.com for a feasibility of a custom tabulation on a fee-for-service basis.

    Inspiration

    Neilsberg Research Team curates, analyze and publishes demographics and economic data from a variety of public and proprietary sources, each of which often includes multiple surveys and programs. The large majority of Neilsberg Research aggregated datasets and insights is made available for free download at https://www.neilsberg.com/research/.

    Recommended for further research

    This dataset is a part of the main dataset for Cardiff Population by Gender. You can refer the same here

  13. g

    2018-based local authority population projections for Wales, 2018 to 2043

    • statswales.gov.wales
    json
    Updated Aug 2021
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    (2021). 2018-based local authority population projections for Wales, 2018 to 2043 [Dataset]. https://statswales.gov.wales/Catalogue/Population-and-Migration/Population/Projections/Local-Authority/2018-based/populationprojections-by-localauthority-year
    Explore at:
    jsonAvailable download formats
    Dataset updated
    Aug 2021
    Area covered
    Wales
    Description

    This dataset provides population projections for local authorities in Wales by sex, single year of age and each year from the base year of 2018, through the projection period to 2043. This is the fifth set of population projections published for the 22 local authorities in Wales. Note that the projections become increasingly uncertain the further we try to look into the future.

  14. Data zebra mussel Cardiff Bay

    • figshare.com
    • portalcientifico.uvigo.gal
    txt
    Updated May 16, 2020
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Matteo Rolla; Sofia Consuegra; David Hall; Carlos Garcia de Leaniz (2020). Data zebra mussel Cardiff Bay [Dataset]. http://doi.org/10.6084/m9.figshare.8216279.v1
    Explore at:
    txtAvailable download formats
    Dataset updated
    May 16, 2020
    Dataset provided by
    Figsharehttp://figshare.com/
    Authors
    Matteo Rolla; Sofia Consuegra; David Hall; Carlos Garcia de Leaniz
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Cardiff Bay, Cardiff
    Description

    Datasets for MSSeasonal and spatial variation in growth and abundance of zebra mussel (Dreissena polymorpha) in a recently invaded artificial lake: implications for management

  15. Population of the UK 1937-2023, by gender

    • statista.com
    • ai-chatbox.pro
    Updated Jun 26, 2025
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Statista (2025). Population of the UK 1937-2023, by gender [Dataset]. https://www.statista.com/statistics/281240/population-of-the-united-kingdom-uk-by-gender/
    Explore at:
    Dataset updated
    Jun 26, 2025
    Dataset authored and provided by
    Statistahttp://statista.com/
    Area covered
    United Kingdom
    Description

    In 2023, the population of the United Kingdom was around **** million, with approximately **** million women and **** million men. Since 1953, the male population of the UK has grown by around *** million, while the female population has increased by approximately *** million. Throughout this provided time period, the female population of the UK has consistently outnumbered the male population. UK population one of the largest in Europe As of 2022, the population of the United Kingdom was the largest it has ever been, and with growth expected to continue, the forecasted population of the United Kingdom is expected to reach over ** million by the 2030s. Despite the relatively small size of its territory, the UK has one of the largest populations among European countries, slightly larger than France but smaller than Russia and Germany. As of 2022, the population density of the UK was approximately *** people per square kilometer, with London by far the most densely populated area, and Scotland the most sparsely populated. Dominance of London As seen in the data regarding population density, the population of the United Kingdom is not evenly distributed across the country. Within England, London has a population of almost **** million, making it significantly bigger than the next largest cities of Birmingham and Manchester. As of 2022, Scotland's largest city, Glasgow had a population of around *** million, with the largest cities in Northern Ireland, and Wales being Belfast and Cardiff, which had populations of ******* and ******* respectively.

  16. n

    Data from: Otterly delicious: Spatiotemporal variation in the diet of a...

    • data.niaid.nih.gov
    • search.dataone.org
    • +2more
    zip
    Updated Apr 17, 2023
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Lorna Drake; Jordan Cuff; Sergio Bedmar Castillo; Robbie McDonald; W. O. C. Symondson; Elizabeth Chadwick (2023). Otterly delicious: Spatiotemporal variation in the diet of a recovering population of Eurasian otters (Lutra lutra) revealed through DNA metabarcoding and morphological analysis of prey remains [Dataset]. http://doi.org/10.5061/dryad.vdncjsz0c
    Explore at:
    zipAvailable download formats
    Dataset updated
    Apr 17, 2023
    Dataset provided by
    University of Exeter
    Estación Biológica de Doñana
    Cardiff University
    Newcastle University
    Authors
    Lorna Drake; Jordan Cuff; Sergio Bedmar Castillo; Robbie McDonald; W. O. C. Symondson; Elizabeth Chadwick
    License

    https://spdx.org/licenses/CC0-1.0.htmlhttps://spdx.org/licenses/CC0-1.0.html

    Description

    Eurasian otters are apex predators of freshwater ecosystems and a recovering species across much of their European range; investigating the dietary variation of this predator over time and space therefore provides opportunities to identify changes in freshwater trophic interactions and factors influencing the conservation of otter populations. Here we sampled faeces from 300 dead otters across England and Wales between 2007 and 2016, conducting both morphological analysis of prey remains and dietary DNA metabarcoding. Comparison of these methods showed that greater taxonomic resolution and breadth could be achieved using DNA metabarcoding but combining data from both methodologies gave the most comprehensive dietary description. All otter demographics exploited a broad range of taxa and variation likely reflected changes in prey distributions and availability across the landscape. This study provides novel insights into the trophic generalism and adaptability of otters across Britain, which is likely to have aided their recent population recovery, and may increase their resilience to future environmental changes. Methods Sample and data collection Samples and associated metadata were acquired from 300 otters collected between 2007 and 2016, obtained from the Cardiff University Otter Project, a national monitoring programme for dead otters sampled from across Great Britain (https://www.cardiff.ac.uk/otter-project). Most otters collected were killed by road traffic accidents, with a minority dying through drowning, being shot, starvation, or disease. Information on date (year and month) and location (as grid reference) of carcass collection were recorded at the site of collection. Grid references were used to plot data for spatial analysis. Detailed post-mortems were performed for each carcass during which biotic data were obtained (e.g., sex and size of individual). Faecal samples were collected from the rectum during post-mortem examination, wrapped in foil and stored at -20 °C. Following post-mortems, scaled mass index (SMI) was calculated for each individual otter using the following equation (Peig and Green 2009; Peig and Green 2010): SMI = Mi [ L0 / Li ] bSMA Mi is the body mass and Li is the length measurement of individual i, L0 is the mean length measurement for the entire study population and bSMA is the scaling exponent. Length was measured from nose to tail-tip to the nearest 5 mm. Mean length and the scaling exponent were both calculated from all otter data available as of January 2017 (n = 2477). The scaling exponent is the slope from the standard major axis regression of log-transformed values of mass against length.Otters were also classified into size categories based on their total length (nose to tail tip) using the ‘bins’ function in R (OneR v2.2 package; von Jouanne-Diedrich 2017), which applies a clustering method using Jenks natural breaks optimisation. Male and female otters were clustered separately into small (males <1046 mm, females <936 mm long), medium (males between 1046 mm and 1131 mm, females between 936 mm and 1031 mm), and large (males > 1131 mm, females > 1031 mm). Spatial data Spatial data describing proximity to the coast, urban land use, altitude, slope, and primary water habitat were collated using QGIS version 3.4.4 (QGIS Development Team 2019). Distance from the coast was calculated as the shortest distance (km) along a river from the location at which the otter was found to the low tide point of the mouth of the river (hereafter referred to as ‘river distance’), using the package RivEX (Hornby 2020), because otters tend to travel along water courses rather than across land. As most otters were found as roadkill, and not all were adjacent to rivers, each otter was first assigned to the nearest river. Locations more than 1000 m from a river were checked, and if there was more than one river along which the otter might have travelled, then river distance was calculated for all rivers and a mean distance used. All otters within 1000 m of the coast were given a distance of zero if they were closer to the coastline than a river.Otter locations were mapped as points, and circular areas of 10 km diameter (hereafter referred to as ‘buffers’) mapped around each. Faecal samples typically reflect diet from the preceding 24-72 hours (in mammals; Deagle et al. 2005; Casper et al. 2007; Thalinger et al. 2016), during which time otters can travel up to 10 km (Chanin 2003), it was therefore deemed appropriate to use this distance to reflect the land used by otters within the sample timeframe. Buffers were used to calculate proportions of urban land-use (i.e., urban and suburban land use extracted from the 25 m resolution UK land cover map from 2007; Morton et al. 2011), mean altitude and mean slope (extracted from European Digital Elevation Model (EU-DEM) map; European Environment Agency 2011). We chose to focus on urban land-use as urbanisation may affect otter diet either through changes to prey assemblages or disturbance affecting an otter's ability to forage. Longitude, altitude, and slope were highly correlated, therefore longitude was used in further analyses as a representative for the three variables.Otters in England and Wales typically feed in freshwater river systems but will opportunistically feed in lakes or at the coast if these habitats are within range (Jędrzejewska et al. 2001; Clavero et al. 2004; Parry et al. 2011). Available prey differ between lakes, coasts, and river systems, as well as between different parts of the river network (e.g., tributary, main river channel). To assess whether water habitat type influenced dietary variation, we designated each otter to one of the following: transitional water (coastal and estuarine), lake, main river channel, or tributary (based on Water Framework Directive 2000/60/EC designations mapped using GIS shapefiles provided by Natural Resources Wales and Environment Agency). Otters within 2.5 km (half of a buffer’s radius) from a lake or transitional water were assigned to that habitat, whilst those further away were assumed to be feeding primarily in the river network. The RivEX network map (Hornby 2020) was used to map all rivers, and individuals were further categorised according to whether their assumed habitat was primarily a main river or tributary. To do this, the total length of main river channels and tributaries was calculated within each 10 km buffer. The length of main channels was weighted 10 times greater to account for the greater cross-section of a main channel compared to tributaries (Benda et al. 2004) since waterways with greater areas are assumed to support more prey (Samarasin et al. 2014). The sum of weighted main river lengths and tributary lengths was calculated, and if more than 50 percent of each buffer was attributed to main river channel, the otter was assigned to the main river channel, otherwise it was assigned to tributary. Morphological analysis Each faecal sample was first thawed, homogenised by hand in a sterile container, and divided into subsamples; three samples weighing 200 mg each were collected for DNA analysis (one sample used for DNA extraction and the other two frozen as back-ups) and the remaining material was used for morphological analysis. Subsamples undergoing morphological analysis were then soaked in a solution of water and liquid biological detergent (water:detergent, 10:1) for 24 hours. Samples were passed through sieves with a 0.5 mm mesh and washed with water to ensure only hard parts remained which were air-dried for 24 hours. A record was made of any samples that did not contain any hard parts. Recognisable remains (bones, fish scales, feathers, fur) underwent microscopic identification using a range of keys (Libois and Hallet-Libois 1987; Coburn and Gaglione 1992; Prenda and Granado-Lorencio 1992; Prenda et al. 1997; Watt et al. 1997; Miranda and Escala 2002; Conroy et al. 2005; Tercerie et al. 2019; University of Nottingham 2020). Prey remains were identified to the finest possible taxonomic resolution and recorded as present within or absent from a sample. DNA metabarcoding analysis Faecal samples were processed for HTS, and subsequent bioinformatic analysis was conducted, as described in Drake et al. (2022). In summary, DNA was extracted from a subsample of faecal material and amplified using two metabarcoding primer pairs, designed to amplify regions of the 16S rRNA and cytochrome c oxidase subunit I (COI) genes, each primer having 10 base pair molecular identifier tags (MID tags) to facilitate post-bioinformatic sample identification.Two primer sets from different barcoding regions were selected to overcome biases associated with each region and broaden the range of taxa amplified: the 16S barcoding region selected for vertebrate DNA, and cytochrome c oxidase subunit I (COI) for invertebrate DNA. For 16S, the novel primer pair FN2199 (5’- yayaagacgagaagaccct -3’) and R8B7 (5’- ttatccctrgggtarcthgg -3’; modified for this study from Deagle et al. 2009) were used, which targeted a 225-267 bp amplicon (including primers). For COI, the primer pair Mod_mCOIintF (5’- ggwacwggwtgaacwgtwtaycc -3’; modified for this study from Leray et al. 2013) and HCO-2198 (5’- taaacttcagggtgaccaaaaaatca -3’; Folmer et al. 1994) were used, which targeted a 365 bp amplicon (including primers). Primers underwent in silico testing using ecoPCR (Boyer et al. 2016) and were further tested in vitro. In silico and vitro tests showed primer sets amplified desired taxa. COI primers were also found to amplify a range of vertebrate taxa but did not cover the same range as the 16S primers, therefore justifying the use of both primer sets beyond the benefit of different primer pairs exhibiting different biases.Faecal samples were processed alongside extraction and PCR negative controls, repeat samples, and mock communities, which comprised standardised mixtures of DNA of

  17. Percentage of people in Wales who say they can speak Welsh by local...

    • statista.com
    • ai-chatbox.pro
    Updated Jul 3, 2025
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Statista (2025). Percentage of people in Wales who say they can speak Welsh by local authority 2024 [Dataset]. https://www.statista.com/statistics/383038/welsh-language-speakers-by-region/
    Explore at:
    Dataset updated
    Jul 3, 2025
    Dataset authored and provided by
    Statistahttp://statista.com/
    Area covered
    Wales
    Description

    Approximately 28 percent of people in Wales advised that they were able to speak Welsh in 20224. The share of people who could speak Welsh ranged from over three-quarters of the population in Gwynedd, located in the North West of Wales, to 14.5 percent in Blaenau Gwent, a small county borough in the South East of the country.

  18. f

    Demographic and Risk Factors.

    • plos.figshare.com
    xls
    Updated Jun 2, 2023
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Shuyan Gu; Yuhang Zeng; Demin Yu; Xiaoqian Hu; Hengjin Dong (2023). Demographic and Risk Factors. [Dataset]. http://doi.org/10.1371/journal.pone.0167190.t001
    Explore at:
    xlsAvailable download formats
    Dataset updated
    Jun 2, 2023
    Dataset provided by
    PLOS ONE
    Authors
    Shuyan Gu; Yuhang Zeng; Demin Yu; Xiaoqian Hu; Hengjin Dong
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Description

    Demographic and Risk Factors.

  19. g

    National Survey for Wales – adult lifestyle by local authority and health...

    • statswales.gov.wales
    Updated Jul 2023
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    (2023). National Survey for Wales – adult lifestyle by local authority and health board [Dataset]. https://statswales.gov.wales/Catalogue/National-Survey-for-Wales/Population-Health/Adult-Lifestyles/adultlifestyles-by-healthboard-from-202021
    Explore at:
    Dataset updated
    Jul 2023
    Area covered
    Wales
    Description

    Information on health related lifestyle among adults in Wales by health board.

  20. N

    Cardiff, AL Population Breakdown by Gender Dataset: Male and Female...

    • neilsberg.com
    csv, json
    Updated Feb 24, 2025
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Neilsberg Research (2025). Cardiff, AL Population Breakdown by Gender Dataset: Male and Female Population Distribution // 2025 Edition [Dataset]. https://www.neilsberg.com/research/datasets/b225661d-f25d-11ef-8c1b-3860777c1fe6/
    Explore at:
    json, csvAvailable download formats
    Dataset updated
    Feb 24, 2025
    Dataset authored and provided by
    Neilsberg Research
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Cardiff, Alabama
    Variables measured
    Male Population, Female Population, Male Population as Percent of Total Population, Female Population as Percent of Total Population
    Measurement technique
    The data presented in this dataset is derived from the latest U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates. To measure the two variables, namely (a) population and (b) population as a percentage of the total population, we initially analyzed and categorized the data for each of the gender classifications (biological sex) reported by the US Census Bureau. For further information regarding these estimates, please feel free to reach out to us via email at research@neilsberg.com.
    Dataset funded by
    Neilsberg Research
    Description
    About this dataset

    Context

    The dataset tabulates the population of Cardiff by gender, including both male and female populations. This dataset can be utilized to understand the population distribution of Cardiff across both sexes and to determine which sex constitutes the majority.

    Key observations

    There is a majority of male population, with 64.29% of total population being male. Source: U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates.

    Content

    When available, the data consists of estimates from the U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates.

    Scope of gender :

    Please note that American Community Survey asks a question about the respondents current sex, but not about gender, sexual orientation, or sex at birth. The question is intended to capture data for biological sex, not gender. Respondents are supposed to respond with the answer as either of Male or Female. Our research and this dataset mirrors the data reported as Male and Female for gender distribution analysis. No further analysis is done on the data reported from the Census Bureau.

    Variables / Data Columns

    • Gender: This column displays the Gender (Male / Female)
    • Population: The population of the gender in the Cardiff is shown in this column.
    • % of Total Population: This column displays the percentage distribution of each gender as a proportion of Cardiff total population. Please note that the sum of all percentages may not equal one due to rounding of values.

    Good to know

    Margin of Error

    Data in the dataset are based on the estimates and are subject to sampling variability and thus a margin of error. Neilsberg Research recommends using caution when presening these estimates in your research.

    Custom data

    If you do need custom data for any of your research project, report or presentation, you can contact our research staff at research@neilsberg.com for a feasibility of a custom tabulation on a fee-for-service basis.

    Inspiration

    Neilsberg Research Team curates, analyze and publishes demographics and economic data from a variety of public and proprietary sources, each of which often includes multiple surveys and programs. The large majority of Neilsberg Research aggregated datasets and insights is made available for free download at https://www.neilsberg.com/research/.

    Recommended for further research

    This dataset is a part of the main dataset for Cardiff Population by Race & Ethnicity. You can refer the same here

Share
FacebookFacebook
TwitterTwitter
Email
Click to copy link
Link copied
Close
Cite
Neilsberg Research (2025). Cardiff, AL Age Group Population Dataset: A Complete Breakdown of Cardiff Age Demographics from 0 to 85 Years and Over, Distributed Across 18 Age Groups // 2025 Edition [Dataset]. https://www.neilsberg.com/research/datasets/451613f2-f122-11ef-8c1b-3860777c1fe6/

Cardiff, AL Age Group Population Dataset: A Complete Breakdown of Cardiff Age Demographics from 0 to 85 Years and Over, Distributed Across 18 Age Groups // 2025 Edition

Explore at:
csv, jsonAvailable download formats
Dataset updated
Feb 22, 2025
Dataset authored and provided by
Neilsberg Research
License

Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
License information was derived automatically

Area covered
Cardiff, Alabama
Variables measured
Population Under 5 Years, Population over 85 years, Population Between 5 and 9 years, Population Between 10 and 14 years, Population Between 15 and 19 years, Population Between 20 and 24 years, Population Between 25 and 29 years, Population Between 30 and 34 years, Population Between 35 and 39 years, Population Between 40 and 44 years, and 9 more
Measurement technique
The data presented in this dataset is derived from the latest U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates. To measure the two variables, namely (a) population and (b) population as a percentage of the total population, we initially analyzed and categorized the data for each of the age groups. For age groups we divided it into roughly a 5 year bucket for ages between 0 and 85. For over 85, we aggregated data into a single group for all ages. For further information regarding these estimates, please feel free to reach out to us via email at research@neilsberg.com.
Dataset funded by
Neilsberg Research
Description
About this dataset

Context

The dataset tabulates the Cardiff population distribution across 18 age groups. It lists the population in each age group along with the percentage population relative of the total population for Cardiff. The dataset can be utilized to understand the population distribution of Cardiff by age. For example, using this dataset, we can identify the largest age group in Cardiff.

Key observations

The largest age group in Cardiff, AL was for the group of age 40 to 44 years years with a population of 14 (33.33%), according to the ACS 2019-2023 5-Year Estimates. At the same time, the smallest age group in Cardiff, AL was the Under 5 years years with a population of 0 (0%). Source: U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates

Content

When available, the data consists of estimates from the U.S. Census Bureau American Community Survey (ACS) 2019-2023 5-Year Estimates

Age groups:

  • Under 5 years
  • 5 to 9 years
  • 10 to 14 years
  • 15 to 19 years
  • 20 to 24 years
  • 25 to 29 years
  • 30 to 34 years
  • 35 to 39 years
  • 40 to 44 years
  • 45 to 49 years
  • 50 to 54 years
  • 55 to 59 years
  • 60 to 64 years
  • 65 to 69 years
  • 70 to 74 years
  • 75 to 79 years
  • 80 to 84 years
  • 85 years and over

Variables / Data Columns

  • Age Group: This column displays the age group in consideration
  • Population: The population for the specific age group in the Cardiff is shown in this column.
  • % of Total Population: This column displays the population of each age group as a proportion of Cardiff total population. Please note that the sum of all percentages may not equal one due to rounding of values.

Good to know

Margin of Error

Data in the dataset are based on the estimates and are subject to sampling variability and thus a margin of error. Neilsberg Research recommends using caution when presening these estimates in your research.

Custom data

If you do need custom data for any of your research project, report or presentation, you can contact our research staff at research@neilsberg.com for a feasibility of a custom tabulation on a fee-for-service basis.

Inspiration

Neilsberg Research Team curates, analyze and publishes demographics and economic data from a variety of public and proprietary sources, each of which often includes multiple surveys and programs. The large majority of Neilsberg Research aggregated datasets and insights is made available for free download at https://www.neilsberg.com/research/.

Recommended for further research

This dataset is a part of the main dataset for Cardiff Population by Age. You can refer the same here

Search
Clear search
Close search
Google apps
Main menu