14 datasets found
  1. b

    Ethnic fractionalization in Ethiopia and their coincidence with marginality...

    • bonndata.uni-bonn.de
    • daten.zef.de
    bin, jpeg, png, xml
    Updated Sep 18, 2023
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Christine Husmann; Christine Husmann (2023). Ethnic fractionalization in Ethiopia and their coincidence with marginality hotspots, 2007 [Dataset]. http://doi.org/10.60507/FK2/NA7AGS
    Explore at:
    png(28939), bin(118839), xml(24964), jpeg(533276)Available download formats
    Dataset updated
    Sep 18, 2023
    Dataset provided by
    bonndata
    Authors
    Christine Husmann; Christine Husmann
    License

    Attribution-ShareAlike 4.0 (CC BY-SA 4.0)https://creativecommons.org/licenses/by-sa/4.0/
    License information was derived automatically

    Time period covered
    Jan 1, 2007 - Dec 31, 2007
    Area covered
    Ethiopia
    Description

    This map shows ethnic fractionalization. The Ethnic Fractionalization Index is calculated using data from the 2007 Population and Housing Census. The striped areas show where marginality hotspots are. The map reveals that marginality hotspots are ethnically more homogeneous than non-hotspot areas. Quality/Lineage: This map shows the ethnic fractionalization index as developed by Taylor and Hudson (1970). The index is calculated as 1- sum(gi), where g is the proportion of people belonging to ethnic group i. The sum runs from 1 to n, where n is the number of ethnic groups in the country. The data used is taken from the 2007 Population and Housing Census (CSA, 2008) and is available on woreda (district) level.

  2. Ethiopia: High Resolution Population Density Maps + Demographic Estimates -...

    • ckan.africadatahub.org
    Updated Sep 30, 2022
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    ckan.africadatahub.org (2022). Ethiopia: High Resolution Population Density Maps + Demographic Estimates - Dataset - ADH Data Portal [Dataset]. https://ckan.africadatahub.org/dataset/ethiopia-hrpdmde
    Explore at:
    Dataset updated
    Sep 30, 2022
    Dataset provided by
    CKANhttps://ckan.org/
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Ethiopia
    Description

    The world's most accurate population datasets. Seven maps/datasets for the distribution of various populations in Ethiopia: (1) Overall population density (2) Women (3) Men (4) Children (ages 0-5) (5) Youth (ages 15-24) (6) Elderly (ages 60+) (7) Women of reproductive age (ages 15-49). Methodology These high-resolution maps are created using machine learning techniques to identify buildings from commercially available satellite images. This is then overlayed with general population estimates based on publicly available census data and other population statistics at Columbia University. The resulting maps are the most detailed and actionable tools available for aid and research organizations. For more information about the methodology used to create our high resolution population density maps and the demographic distributions, click here. For information about how to use HDX to access these datasets, please visit: https://dataforgood.fb.com/docs/high-resolution-population-density-maps-demographic-estimates-documentation/ Adjustments to match the census population with the UN estimates are applied at the national level. The UN estimate for a given country (or state/territory) is divided by the total census estimate of population for the given country. The resulting adjustment factor is multiplied by each administrative unit census value for the target year. This preserves the relative population totals across administrative units while matching the UN total. More information can be found here

  3. W

    Ethiopia: High Resolution Population Density Maps + Demographic Estimates

    • cloud.csiss.gmu.edu
    csv, geotiff
    Updated Oct 29, 2021
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Africa Data Hub (2021). Ethiopia: High Resolution Population Density Maps + Demographic Estimates [Dataset]. https://cloud.csiss.gmu.edu/uddi/dataset/ethiopia-high-resolution-population-density-maps-demographic-estimates
    Explore at:
    csv, geotiffAvailable download formats
    Dataset updated
    Oct 29, 2021
    Dataset provided by
    Africa Data Hub
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Ethiopia
    Description

    VERSION 1.5. The world's most accurate population datasets. Seven maps/datasets for the distribution of various populations in Nigeria: (1) Overall population density (2) Women (3) Men (4) Children (ages 0-5) (5) Youth (ages 15-24) (6) Elderly (ages 60+) (7) Women of reproductive age (ages 15-49).

    Methodology

    These high-resolution maps are created using machine learning techniques to identify buildings from commercially available satellite images. This is then overlayed with general population estimates based on publicly available census data and other population statistics at Columbia University. The resulting maps are the most detailed and actionable tools available for aid and research organizations. For more information about the methodology used to create our high resolution population density maps and the demographic distributions, click [here](https://dataforgood.fb.com/docs/methodology-high-resolution-population-density-maps-demographic-estimates/

    For information about how to use HDX to access these datasets, please visit: https://dataforgood.fb.com/docs/high-resolution-population-density-maps-demographic-estimates-documentation/

    Adjustments to match the census population with the UN estimates are applied at the national level. The UN estimate for a given country (or state/territory) is divided by the total census estimate of population for the given country. The resulting adjustment factor is multiplied by each administrative unit census value for the target year. This preserves the relative population totals across administrative units while matching the UN total. More information can be found here

  4. k

    Continent of Africa: High Resolution Population Density Maps

    • lschub.kalro.org
    • kenya.lsc-hubs.org
    • +1more
    Updated Dec 13, 2024
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    (2024). Continent of Africa: High Resolution Population Density Maps [Dataset]. https://lschub.kalro.org/cat/collections/metadata:main/items/meta-population-density
    Explore at:
    Dataset updated
    Dec 13, 2024
    Area covered
    Africa
    Description

    These 28 tiff files represent 2015 population estimates. However, please note that many of the country-level files include 2020 population estimates including: Angola, Benin, Botswana, Burundi, Cameroon, Cabo Verde, Cote d'Ivoire, Djibouti, Eritrea, Eswatini, The Gambia, Ghana, Lesotho, Liberia, Mozambique, Namibia, Sao Tome & Principe, Sierra Leone, South Africa, Togo, Zambia, and Zimbabwe. South Sudan, Sudan, Somalia and Ethiopia are intentionally omitted from this dataset. However, a country-level dataset for Ethiopia can be found at https://data.humdata.org/dataset/ethiopia-high-resolution-population-density-maps-demographic-estimates.

  5. Demographic and Health Survey 2016 - Ethiopia

    • datacatalog.ihsn.org
    • catalog.ihsn.org
    • +1more
    Updated Oct 10, 2017
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Central Statistical Agency (CSA) (2017). Demographic and Health Survey 2016 - Ethiopia [Dataset]. https://datacatalog.ihsn.org/catalog/7199
    Explore at:
    Dataset updated
    Oct 10, 2017
    Dataset provided by
    Central Statistical Agencyhttps://ess.gov.et/
    Authors
    Central Statistical Agency (CSA)
    Time period covered
    2016
    Area covered
    Ethiopia
    Description

    Abstract

    The 2016 Ethiopia Demographic and Health Survey (EDHS) is the fourth Demographic and Health Survey conducted in Ethiopia. It was implemented by the Central Statistical Agency (CSA) at the request of the Federal Ministry of Health (FMoH). The primary objective of the 2016 EDHS is to provide up-to-date estimates of key demographic and health indicators. The EDHS provides a comprehensive overview of population, maternal, and child health issues in Ethiopia. More specifically, the 2016 EDHS: - Collected data at the national level that allowed calculation of key demographic indicators, particularly fertility and under-5 and adult mortality rates - Explored the direct and indirect factors that determine levels and trends of fertility and child mortality ? Measured levels of contraceptive knowledge and practice - Collected data on key aspects of family health, including immunisation coverage among children, prevalence and treatment of diarrhoea and other diseases among children under age 5, and maternity care indicators such as antenatal visits and assistance at delivery - Obtained data on child feeding practices, including breastfeeding - Collected anthropometric measures to assess the nutritional status of children under age 5, women age 15-49, and men age 15-59 - Conducted haemoglobin testing on eligible children age 6-59 months, women age 15-49, and men age 15-59 to provide information on the prevalence of anaemia in these groups - Collected data on knowledge and attitudes of women and men about sexually transmitted diseases and HIV/AIDS and evaluated potential exposure to the risk of HIV infection by exploring high-risk behaviours and condom use - Conducted HIV testing of dried blood spot (DBS) samples collected from women age 15-49 and men age 15-59 to provide information on the prevalence of HIV among adults of reproductive age - Collected data on the prevalence of injuries and accidents among all household members - Collected data on knowledge and prevalence of fistula and female genital mutilation or cutting (FGM/C) among women age 15-49 and their daughters age 0-14 - Obtained data on women’s experience of emotional, physical, and sexual violence.

    Geographic coverage

    National

    Analysis unit

    • Household
    • Individual
    • Children age 0-5
    • Woman age 15-49
    • Man age 15-59
    • Health facility

    Universe

    The survey covered all de jure household members (usual residents), women age 15-49 years and men age 15-59 years resident in the household.

    Kind of data

    Sample survey data [ssd]

    Sampling procedure

    The sampling frame used for the 2016 EDHS is the Ethiopia Population and Housing Census (PHC), which was conducted in 2007 by the Ethiopia Central Statistical Agency. The census frame is a complete list of 84,915 enumeration areas (EAs) created for the 2007 PHC. An EA is a geographic area covering on average 181 households. The sampling frame contains information about the EA location, type of residence (urban or rural), and estimated number of residential households. With the exception of EAs in six zones of the Somali region, each EA has accompanying cartographic materials. These materials delineate geographic locations, boundaries, main access, and landmarks in or outside the EA that help identify the EA. In Somali, a cartographic frame was used in three zones where sketch maps delineating the EA geographic boundaries were available for each EA; in the remaining six zones, satellite image maps were used to provide a map for each EA.

    Administratively, Ethiopia is divided into nine geographical regions and two administrative cities. The sample for the 2016 EDHS was designed to provide estimates of key indicators for the country as a whole, for urban and rural areas separately, and for each of the nine regions and the two administrative cities.

    The 2016 EDHS sample was stratified and selected in two stages. Each region was stratified into urban and rural areas, yielding 21 sampling strata. Samples of EAs were selected independently in each stratum in two stages. Implicit stratification and proportional allocation were achieved at each of the lower administrative levels by sorting the sampling frame within each sampling stratum before sample selection, according to administrative units in different levels, and by using a probability proportional to size selection at the first stage of sampling.

    For further details on sample design, see Appendix A of the final report.

    Mode of data collection

    Face-to-face [f2f]

    Research instrument

    Five questionnaires were used for the 2016 EDHS: the Household Questionnaire, the Woman’s Questionnaire, the Man’s Questionnaire, the Biomarker Questionnaire, and the Health Facility Questionnaire. These questionnaires, based on the DHS Program’s standard Demographic and Health Survey questionnaires, were adapted to reflect the population and health issues relevant to Ethiopia. Input was solicited from various stakeholders representing government ministries and agencies, nongovernmental organisations, and international donors. After all questionnaires were finalised in English, they were translated into Amarigna, Tigrigna, and Oromiffa.

    Cleaning operations

    All electronic data files for the 2016 EDHS were transferred via IFSS to the CSA central office in Addis Ababa, where they were stored on a password-protected computer. The data processing operation included secondary editing, which required resolution of computer-identified inconsistencies and coding of openended questions; it also required generating a file for the list of children for whom a vaccination card was not seen by the interviewers and whose vaccination records had to be checked at health facilities. The data were processed by two individuals who took part in the main fieldwork training; they were supervised by two senior staff from CSA. Data editing was accomplished using CSPro software. During the duration of fieldwork, tables were generated to check various data quality parameters and specific feedback was given to the teams to improve performance. Secondary editing and data processing were initiated in January 2016 and completed in August 2016.

    Response rate

    A total of 18,008 households were selected for the sample, of which 17,067 were occupied. Of the occupied households, 16,650 were successfully interviewed, yielding a response rate of 98%.

    In the interviewed households, 16,583 eligible women were identified for individual interviews. Interviews were completed with 15,683 women, yielding a response rate of 95%. A total of 14,795 eligible men were identified in the sampled households and 12,688 were successfully interviewed, yielding a response rate of 86%. Although overall there was little variation in response rates according to residence, response rates among men were higher in rural than in urban areas.

    Sampling error estimates

    The estimates from a sample survey are affected by two types of errors: non-sampling errors and sampling errors. Non-sampling errors are the results of mistakes made in implementing data collection and data processing, such as failure to locate and interview the correct household, misunderstanding the questions by either the interviewer or the respondent, and data entry errors. Although numerous efforts were made during the implementation of the 2016 Ethiopia DHS (EDHS) to minimise this type of error, non-sampling errors are impossible to avoid and are difficult to evaluate statistically.

    Sampling errors, on the other hand, can be evaluated statistically. The sample of respondents selected in the 2016 EDHS is only one of many samples that could have been selected from the same population, by using the same design and the expected size. Each of those samples would yield results that differ somewhat from the results of the actual sample selected. Sampling errors are a measure of the variability between all possible samples. Although the degree of variability is not known exactly, it can be estimated from the survey results.

    Sampling error is usually measured in terms of the standard error for a particular statistic (such as mean or percentage), which is the square root of the variance. The standard error can be used to calculate confidence intervals within which the true value for the population can reasonably be assumed to fall. For example, for any given statistic calculated from a sample survey, the value of that statistic will fall within a range of plus or minus two times the standard error of that statistic in 95% of all possible samples of identical size and design.

    If the sample of respondents had been selected as a simple random sample, it would have been possible to use straightforward formulas for calculating sampling errors. However, the 2016 EDHS sample is the result of a multi-stage stratified design and, consequently, it was necessary to use more complex formulae. Sampling errors are computed in either ISSA or SAS, with programs developed by ICF International. These programs use the Taylor linearisation method of variance estimation for survey estimates that are means, proportions, or ratios. The Jackknife repeated replication method is used for variance estimation of more complex statistics such as fertility and mortality rates.

    A more detailed description of estimates of sampling errors are presented in Appendix B of the survey final report.

    Data appraisal

    Data Quality Tables - Household age distribution - Age distribution of eligible and interviewed women - Age distribution of eligible and interviewed men - Completeness of reporting - Births by calendar

  6. f

    Validity of MUAC in detecting moderate acute malnutrition among different...

    • plos.figshare.com
    xls
    Updated Jun 16, 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Abera Lambebo; Yordanos Mezemir; Dessalegn Tamiru; Tefera Belachew (2023). Validity of MUAC in detecting moderate acute malnutrition among different ethnic groups of Ethiopia as compared to as compared to weight for Height Z score as gold standard. [Dataset]. http://doi.org/10.1371/journal.pone.0273634.t003
    Explore at:
    xlsAvailable download formats
    Dataset updated
    Jun 16, 2023
    Dataset provided by
    PLOS ONE
    Authors
    Abera Lambebo; Yordanos Mezemir; Dessalegn Tamiru; Tefera Belachew
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Ethiopia
    Description

    Validity of MUAC in detecting moderate acute malnutrition among different ethnic groups of Ethiopia as compared to as compared to weight for Height Z score as gold standard.

  7. The Genetic Architecture of Adaptations to High Altitude in Ethiopia

    • plos.figshare.com
    tiff
    Updated May 31, 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Gorka Alkorta-Aranburu; Cynthia M. Beall; David B. Witonsky; Amha Gebremedhin; Jonathan K. Pritchard; Anna Di Rienzo (2023). The Genetic Architecture of Adaptations to High Altitude in Ethiopia [Dataset]. http://doi.org/10.1371/journal.pgen.1003110
    Explore at:
    tiffAvailable download formats
    Dataset updated
    May 31, 2023
    Dataset provided by
    PLOShttp://plos.org/
    Authors
    Gorka Alkorta-Aranburu; Cynthia M. Beall; David B. Witonsky; Amha Gebremedhin; Jonathan K. Pritchard; Anna Di Rienzo
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Ethiopia
    Description

    Although hypoxia is a major stress on physiological processes, several human populations have survived for millennia at high altitudes, suggesting that they have adapted to hypoxic conditions. This hypothesis was recently corroborated by studies of Tibetan highlanders, which showed that polymorphisms in candidate genes show signatures of natural selection as well as well-replicated association signals for variation in hemoglobin levels. We extended genomic analysis to two Ethiopian ethnic groups: Amhara and Oromo. For each ethnic group, we sampled low and high altitude residents, thus allowing genetic and phenotypic comparisons across altitudes and across ethnic groups. Genome-wide SNP genotype data were collected in these samples by using Illumina arrays. We find that variants associated with hemoglobin variation among Tibetans or other variants at the same loci do not influence the trait in Ethiopians. However, in the Amhara, SNP rs10803083 is associated with hemoglobin levels at genome-wide levels of significance. No significant genotype association was observed for oxygen saturation levels in either ethnic group. Approaches based on allele frequency divergence did not detect outliers in candidate hypoxia genes, but the most differentiated variants between high- and lowlanders have a clear role in pathogen defense. Interestingly, a significant excess of allele frequency divergence was consistently detected for genes involved in cell cycle control and DNA damage and repair, thus pointing to new pathways for high altitude adaptations. Finally, a comparison of CpG methylation levels between high- and lowlanders found several significant signals at individual genes in the Oromo.

  8. f

    Heterozygosity (H), Fixation Index(F), & Panmictic Index (P) for the Ethnic...

    • plos.figshare.com
    xls
    Updated May 30, 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Seile Yohannes; Endashaw Bekele (2023). Heterozygosity (H), Fixation Index(F), & Panmictic Index (P) for the Ethnic Groups computed from 2 polymorphic Loci. [Dataset]. http://doi.org/10.1371/journal.pone.0126897.t005
    Explore at:
    xlsAvailable download formats
    Dataset updated
    May 30, 2023
    Dataset provided by
    PLOS ONE
    Authors
    Seile Yohannes; Endashaw Bekele
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Description

    High heterozygosity & panmictic index has been noted for the Amhara ethnic group, indicating higher diversity. Lower values for heterozygosity in the other groups in turn indicate more homogeneity of these groups.Heterozygosity (H), Fixation Index(F), & Panmictic Index (P) for the Ethnic Groups computed from 2 polymorphic Loci.

  9. Mean allelic frequencies with their variance & Wahlund’s f estimates for the...

    • plos.figshare.com
    xls
    Updated May 30, 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Seile Yohannes; Endashaw Bekele (2023). Mean allelic frequencies with their variance & Wahlund’s f estimates for the Ethnic Groups computed from seven polymorphic fingerprint pattern related Loci. [Dataset]. http://doi.org/10.1371/journal.pone.0126897.t007
    Explore at:
    xlsAvailable download formats
    Dataset updated
    May 30, 2023
    Dataset provided by
    PLOShttp://plos.org/
    Authors
    Seile Yohannes; Endashaw Bekele
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Description

    The estimations have revealed that both the individual values, as well as the mean values for Wahlund’s variance (f) are generally high for the sampled population.Mean allelic frequencies with their variance & Wahlund’s f estimates for the Ethnic Groups computed from seven polymorphic fingerprint pattern related Loci.

  10. WASH KAP and Coverage Survey in Refugee Sites – Shire Region Adi-Harush...

    • microdata.worldbank.org
    • catalog.ihsn.org
    Updated May 13, 2021
    + more versions
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    United Nations High Commissioner for Refugees (UNHCR) (2021). WASH KAP and Coverage Survey in Refugee Sites – Shire Region Adi-Harush Camp, 2017 - Ethiopia [Dataset]. https://microdata.worldbank.org/index.php/catalog/3953
    Explore at:
    Dataset updated
    May 13, 2021
    Dataset provided by
    United Nations High Commissioner for Refugeeshttp://www.unhcr.org/
    Authors
    United Nations High Commissioner for Refugees (UNHCR)
    Time period covered
    2017
    Area covered
    Ethiopia
    Description

    Abstract

    Adi-Harush Refugee Camp is located in the North West of Tigray regional state of Ethiopia, at about 1170 km from the capital Addis Ababa.

    The camp population is 9766 [UNHCR, July, 2017]. The camp hosts Eritrean refugees having different ethnic groups where the majorities are Tigrigna and Saho and some minorities of Tigre and Belian.

    The main objective of this survey was to collect data and information on water, sanitation, and coverage in the Adi-Harush Refugee camp in 2017 and to have base line data for the 2018 interventions. The total sample size was 175 households.

    The study revealed the gravity of the identified problems, which are latrine coverage, safe water management at home level, hand washing practice, and the risk of diarrhea disease.

    Geographic coverage

    Adi-Harush camp, Shire

    Analysis unit

    Household

    Sampling procedure

    The survey was conducted by systematic random sampling method in which all of the households in the refugee camp have same chance to be selected. Since the camp is divided into five zones, the sample sizes to be collected per zone was determined using the sample proportional to the population size. The sampling interval of a zone was determined using total household of the zone divided by the number of samples to be collected from that zone.

    Mode of data collection

    Face-to-face [f2f]

    Research instrument

    The survey questionnaire used to collect the data consists of the following sections: general information and demographics, water collection and storage, drinking water hygiene, hygiene, sanitation, messaging, distribution, diarrhoea prevalence and health seeking behaviour.

    Cleaning operations

    Data was anonymized through decoding and local suppression.

  11. f

    Estimates of Nei’s measures of gene diversity among the ethnic groups based...

    • figshare.com
    xls
    Updated Jun 3, 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Seile Yohannes; Endashaw Bekele (2023). Estimates of Nei’s measures of gene diversity among the ethnic groups based on 7 polymorphic Loci. [Dataset]. http://doi.org/10.1371/journal.pone.0126897.t006
    Explore at:
    xlsAvailable download formats
    Dataset updated
    Jun 3, 2023
    Dataset provided by
    PLOS ONE
    Authors
    Seile Yohannes; Endashaw Bekele
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Description

    A low inter population gene diversity relative to the intra population gene diversity can be seen, implying that only a small fraction of the total population gene diversity occurs due to the differences between the population groups, while a large fraction of this diversity occurs due to individual variations, i.e., within the population groups.Estimates of Nei’s measures of gene diversity among the ethnic groups based on 7 polymorphic Loci.

  12. f

    An ancestral human genetic variant linked to an ancient disease: A novel...

    • plos.figshare.com
    docx
    Updated Jun 3, 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Ephrem Mekonnen; Endashaw Bekele (2023). An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1 [Dataset]. http://doi.org/10.1371/journal.pone.0184931
    Explore at:
    docxAvailable download formats
    Dataset updated
    Jun 3, 2023
    Dataset provided by
    PLOS ONE
    Authors
    Ephrem Mekonnen; Endashaw Bekele
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Description

    The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

  13. f

    Healthy human serum N-glycan profiling reveals the influence of ethnic...

    • plos.figshare.com
    tiff
    Updated May 31, 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Abrha G. Gebrehiwot; Daniel Seifu Melka; Yimenashu Mamo Kassaye; Ibrahim F. Rehan; Shobith Rangappa; Hiroshi Hinou; Toshiya Kamiyama; Shin-Ichiro Nishimura (2023). Healthy human serum N-glycan profiling reveals the influence of ethnic variation on the identified cancer-relevant glycan biomarkers [Dataset]. http://doi.org/10.1371/journal.pone.0209515
    Explore at:
    tiffAvailable download formats
    Dataset updated
    May 31, 2023
    Dataset provided by
    PLOS ONE
    Authors
    Abrha G. Gebrehiwot; Daniel Seifu Melka; Yimenashu Mamo Kassaye; Ibrahim F. Rehan; Shobith Rangappa; Hiroshi Hinou; Toshiya Kamiyama; Shin-Ichiro Nishimura
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Description

    BackgroundMost glycomics studies have focused on understanding disease mechanisms and proposing serum markers for various diseases, yet the influence of ethnic variation on the identified glyco-biomarker remains poorly addressed. This study aimed to investigate the inter-ethnic serum N-glycan variation among US origin control, Japanese, Indian, and Ethiopian healthy volunteers.MethodsHuman serum from 54 healthy subjects of various ethnicity and 11 Japanese hepatocellular carcinoma (HCC) patients were included in the study. We employed a comprehensive glycoblotting-assisted MALDI-TOF/MS-based quantitative analysis of serum N-glycome and fluorescence HPLC-based quantification of sialic acid species. Data representing serum N-glycan or sialic acid levels were compared among the ethnic groups using SPSS software.ResultsTotal of 51 N-glycans released from whole serum glycoproteins could be reproducibly quantified within which 33 glycoforms were detected in all ethnicities. The remaining N-glycans were detected weakly but exclusively either in the Ethiopians (13 glycans) or in all the other ethnic groups (5 glycans). Highest abundance (p < 0.001) of high mannose, core-fucosylated, hyperbranched/hypersialylated N-glycans was demonstrated in Ethiopians. In contrast, only one glycan (m/z 2118) significantly differed among all ethnicities being highest in Indians and lowest in Ethiopians. Glycan abundance trend in Ethiopians was generally close to that of Japanese HCC patients. Glycotyping analysis further revealed ethnic-based disparities mainly in the branched and sialylated structures. Surprisingly, some of the glycoforms greatly elevated in the Ethiopian subjects have been identified as serum biomarkers of various cancers. Sialic acid level was significantly increased primarily in Ethiopians, compared to the other ethnicities.ConclusionThe study revealed ethnic-specific differences in healthy human serum N-glycome with highest abundance of most glycoforms in the Ethiopian ethnicity. The results strongly emphasized the need to consider ethnicity matching for accurate glyco-biomarker identification. Further large-scale study employing various ethnic compositions is needed to verify the current result.

  14. f

    Distribution of HLA-DRB1 and HLA-DQB1 alleles in the Wolaita, and comparison...

    • plos.figshare.com
    xls
    Updated Jun 3, 2023
    Share
    FacebookFacebook
    TwitterTwitter
    Email
    Click to copy link
    Link copied
    Close
    Cite
    Fasil Tekola Ayele; Elena Hailu; Chris Finan; Abraham Aseffa; Gail Davey; Melanie J. Newport; Charles N. Rotimi; Adebowale Adeyemo (2023). Distribution of HLA-DRB1 and HLA-DQB1 alleles in the Wolaita, and comparison of their frequencies with the Ethiopian Oromo and Amhara ethnic groups. [Dataset]. http://doi.org/10.1371/journal.pone.0040206.t004
    Explore at:
    xlsAvailable download formats
    Dataset updated
    Jun 3, 2023
    Dataset provided by
    PLOS ONE
    Authors
    Fasil Tekola Ayele; Elena Hailu; Chris Finan; Abraham Aseffa; Gail Davey; Melanie J. Newport; Charles N. Rotimi; Adebowale Adeyemo
    License

    Attribution 4.0 (CC BY 4.0)https://creativecommons.org/licenses/by/4.0/
    License information was derived automatically

    Area covered
    Ethiopia
    Description

    aThe denominator for each proportion is total number of chromosomes = 2 n.bSource: HLA Nomenclature, http://www.allelefrequencies.net/.cThe symbol NA means P values were not calculated because HLA-DRB1*12 and HLA-DQB1*01 were absent in Oromo and Amhara.

  15. Not seeing a result you expected?
    Learn how you can add new datasets to our index.

Share
FacebookFacebook
TwitterTwitter
Email
Click to copy link
Link copied
Close
Cite
Christine Husmann; Christine Husmann (2023). Ethnic fractionalization in Ethiopia and their coincidence with marginality hotspots, 2007 [Dataset]. http://doi.org/10.60507/FK2/NA7AGS

Ethnic fractionalization in Ethiopia and their coincidence with marginality hotspots, 2007

Explore at:
png(28939), bin(118839), xml(24964), jpeg(533276)Available download formats
Dataset updated
Sep 18, 2023
Dataset provided by
bonndata
Authors
Christine Husmann; Christine Husmann
License

Attribution-ShareAlike 4.0 (CC BY-SA 4.0)https://creativecommons.org/licenses/by-sa/4.0/
License information was derived automatically

Time period covered
Jan 1, 2007 - Dec 31, 2007
Area covered
Ethiopia
Description

This map shows ethnic fractionalization. The Ethnic Fractionalization Index is calculated using data from the 2007 Population and Housing Census. The striped areas show where marginality hotspots are. The map reveals that marginality hotspots are ethnically more homogeneous than non-hotspot areas. Quality/Lineage: This map shows the ethnic fractionalization index as developed by Taylor and Hudson (1970). The index is calculated as 1- sum(gi), where g is the proportion of people belonging to ethnic group i. The sum runs from 1 to n, where n is the number of ethnic groups in the country. The data used is taken from the 2007 Population and Housing Census (CSA, 2008) and is available on woreda (district) level.

Search
Clear search
Close search
Google apps
Main menu