Abstract

IPUMS-International is an effort to inventory, preserve, harmonize, and disseminate census microdata from around the world. The project has collected the world's largest archive of publicly available census samples. The data are coded and documented consistently across countries and over time to facillitate comparative research. IPUMS-International makes these data available to qualified researchers free of charge through a web dissemination system.

The IPUMS project is a collaboration of the Minnesota Population Center, National Statistical Offices, and international data archives. Major funding is provided by the U.S. National Science Foundation and the Demographic and Behavioral Sciences Branch of the National Institute of Child Health and Human Development. Additional support is provided by the University of Minnesota Office of the Vice President for Research, the Minnesota Population Center, and Sun Microsystems.

Geographic coverage

National coverage

Analysis unit

Household

Universe

All housing units and households; all individuals who passed the night of the census date in the dwelling

Kind of data

Census/enumeration data [cen]

Sampling procedure

MICRODATA SOURCE: Central Statistical Agency

SAMPLE DESIGN: Systematic sample of every 10th household with a random start, drawn by the country. NOTE: The sample includes data from both the short and the long questionnaire. Only one-fifth of household received the long questionnaire, thus only 20% of the population have responses for most variables.

SAMPLE UNIT: household

SAMPLE FRACTION: 10%

SAMPLE SIZE (person records): 7,434,086

Mode of data collection

Face-to-face [f2f]

Research instrument

Two census questionnaires, a short form and a long form, collected information in five sections: 1) Area identification, 2) Type of residence and housing identification, 3) Details of persons in the household, 4) Deaths in the household during the last 12 month, and 5) Information on housing unit. The long questionnaire was administerd to 1 in 5 households in each enumeration area. The short questionnaire with a subset of the long questionnaire items corresponding to basic demographic and social characteristics (population size, sex, age, religion, mother tongue, ethnic group, disability and orphanage) was administered to the remaining (non-sample) households.

This map shows ethnic fractionalization. The Ethnic Fractionalization Index is calculated using data from the 2007 Population and Housing Census. The striped areas show where marginality hotspots are. The map reveals that marginality hotspots are ethnically more homogeneous than non-hotspot areas. Quality/Lineage: This map shows the ethnic fractionalization index as developed by Taylor and Hudson (1970). The index is calculated as 1- sum(gi), where g is the proportion of people belonging to ethnic group i. The sum runs from 1 to n, where n is the number of ethnic groups in the country. The data used is taken from the 2007 Population and Housing Census (CSA, 2008) and is available on woreda (district) level.

Geographic coverage

National coverage

Analysis unit

Household Person Housing unit

Universe

The census has counted people on dejure and defacto basis. The dejure population comprises all the persons who belong to a given area at a given time by virtue of usual residence, while under defacto approach people were counted as the residents of the place where they found. In the census, a person is said to be a usual resident of a household (and hence an area) if he/she has been residing in the household continuously for at least six months before the census day or intends to reside in the household for six months or longer. Thus, visitors are not included with the usual (dejure) population. Homeless persons were enumerated in the place where they spent the night on the enumeration day. The 2007 census counted foreign nationals who were residing in the city administration. On the other hand all Ethiopians living abroad were not counted.

Kind of data

Census/enumeration data [cen]

Mode of data collection

Face-to-face [f2f]

Research instrument

Two type sof questionnaires were used to collect census data: i) Short questionnaire ii) Long questionnaire

Unlike the previous censuses, the contents of the short and long questionnaires were similar both for the urban and rural areas as well as for the entire city. But the short and the long questionnaires differ by the number of variables they contained. That is, the short questionnaire was used to collect basic data on population characteristics, such as population size, sex, age, language, ethnic group, religion, orphanhood and disability. Whereas the long questionnaire includes information on marital status, education, economic activity, migration, fertility, mortality, as well as housing stocks and conditions in addition to those questions contained in a short questionnaire.

The third Population and Housing Census of Ethiopia was conducted in May and November 2007. The census findings are organized by age, sex, religion, ethnicity, region and urban and rural residence. This summary report contains an extract of the census data from this first release and the remaining census results will be disseminated subsequently.

Abstract

The Afrobarometer is a comparative series of public attitude surveys that assess African citizen's attitudes to democracy and governance, markets, and civil society, among other topics. The surveys have been undertaken at periodic intervals since 1999. The Afrobarometer's coverage has increased over time. Round 1 (1999-2001) initially covered 7 countries and was later extended to 12 countries. Round 2 (2002-2004) surveyed citizens in 16 countries. Round 3 (2005-2006) 18 countries, Round 4 (2008) 20 countries, Round 5 (2011-2013) 34 countries, Round 6 (2014-2015) 36 countries, Round 7 (2016-2018) 34 countries, and Round 8 (2019-2021). The survey covered 39 countries in Round 9 (2021-2023).

Geographic coverage

National coverage

Analysis unit

Individual

Universe

Citizens of Ethiopia who are 18 years and older

Kind of data

Sample survey data [ssd]

Sampling procedure

Afrobarometer uses national probability samples designed to meet the following criteria. Samples are designed to generate a sample that is a representative cross-section of all citizens of voting age in a given country. The goal is to give every adult citizen an equal and known chance of being selected for an interview. They achieve this by:

• using random selection methods at every stage of sampling; • sampling at all stages with probability proportionate to population size wherever possible to ensure that larger (i.e., more populated) geographic units have a proportionally greater probability of being chosen into the sample.

The sampling universe normally includes all citizens age 18 and older. As a standard practice, we exclude people living in institutionalized settings, such as students in dormitories, patients in hospitals, and persons in prisons or nursing homes. Occasionally, we must also exclude people living in areas determined to be inaccessible due to conflict or insecurity. Any such exclusion is noted in the technical information report (TIR) that accompanies each data set.

Sample size and design Samples usually include either 1,200 or 2,400 cases. A randomly selected sample of n=1200 cases allows inferences to national adult populations with a margin of sampling error of no more than +/-2.8% with a confidence level of 95 percent. With a sample size of n=2400, the margin of error decreases to +/-2.0% at 95 percent confidence level.

The sample design is a clustered, stratified, multi-stage, area probability sample. Specifically, we first stratify the sample according to the main sub-national unit of government (state, province, region, etc.) and by urban or rural location.

Area stratification reduces the likelihood that distinctive ethnic or language groups are left out of the sample. Afrobarometer occasionally purposely oversamples certain populations that are politically significant within a country to ensure that the size of the sub-sample is large enough to be analysed. Any oversamples is noted in the TIR.

Sample stages Samples are drawn in either four or five stages:

Stage 1: In rural areas only, the first stage is to draw secondary sampling units (SSUs). SSUs are not used in urban areas, and in some countries they are not used in rural areas. See the TIR that accompanies each data set for specific details on the sample in any given country. Stage 2: We randomly select primary sampling units (PSU). Stage 3: We then randomly select sampling start points. Stage 4: Interviewers then randomly select households. Stage 5: Within the household, the interviewer randomly selects an individual respondent. Each interviewer alternates in each household between interviewing a man and interviewing a woman to ensure gender balance in the sample.

Ethiopia - Sample size: 2,400 - Sample design: Nationally representative, random, clustered, stratified, multi-stage area probability sample - Stratification: Region and urban-rural location - Stages: PSUs (from strata), start points, households, respondents - PSU selection: Probability Proportionate to Population Size (PPPS) - Cluster size: 8 households per PSU - Household selection: Randomly selected start points, followed by walk pattern using 5/10 interval - Respondent selection: Gender quota filled by alternating interviews between men and women; respondents of appropriate gender listed, after which computer randomly selects individual - Weighting: Weighted to account for individual selection probabilities - Sampling frame: Pre-census frame 2018/19 and projected adult population 2022, ESS

Mode of data collection

Face-to-face [f2f]

Research instrument

The Round 9 questionnaire has been developed by the Questionnaire Committee after reviewing the findings and feedback obtained in previous Rounds, and securing input on preferred new topics from a host of donors, analysts, and users of the data.

The questionnaire consists of three parts: 1. Part 1 captures the steps for selecting households and respondents, and includes the introduction to the respondent and (pp.1-4). This section should be filled in by the Fieldworker. 2. Part 2 covers the core attitudinal and demographic questions that are asked by the Fieldworker and answered by the Respondent (Q1 – Q100). 3. Part 3 includes contextual questions about the setting and atmosphere of the interview, and collects information on the Fieldworker. This section is completed by the Fieldworker (Q101 – Q123).

Response rate

Response rate was 87%.

Sampling error estimates

The sample size yields country-level results with a margin of error of +/-3 percentage points at a 95% confidence level.

Validity of MUAC in detecting moderate acute malnutrition among different ethnic groups of Ethiopia as compared to as compared to weight for Height Z score as gold standard.

Nutritional status of under-five children’s by using WHZ and MUACZ from different regions of Ethiopia (n = 914).

Although hypoxia is a major stress on physiological processes, several human populations have survived for millennia at high altitudes, suggesting that they have adapted to hypoxic conditions. This hypothesis was recently corroborated by studies of Tibetan highlanders, which showed that polymorphisms in candidate genes show signatures of natural selection as well as well-replicated association signals for variation in hemoglobin levels. We extended genomic analysis to two Ethiopian ethnic groups: Amhara and Oromo. For each ethnic group, we sampled low and high altitude residents, thus allowing genetic and phenotypic comparisons across altitudes and across ethnic groups. Genome-wide SNP genotype data were collected in these samples by using Illumina arrays. We find that variants associated with hemoglobin variation among Tibetans or other variants at the same loci do not influence the trait in Ethiopians. However, in the Amhara, SNP rs10803083 is associated with hemoglobin levels at genome-wide levels of significance. No significant genotype association was observed for oxygen saturation levels in either ethnic group. Approaches based on allele frequency divergence did not detect outliers in candidate hypoxia genes, but the most differentiated variants between high- and lowlanders have a clear role in pathogen defense. Interestingly, a significant excess of allele frequency divergence was consistently detected for genes involved in cell cycle control and DNA damage and repair, thus pointing to new pathways for high altitude adaptations. Finally, a comparison of CpG methylation levels between high- and lowlanders found several significant signals at individual genes in the Oromo.

The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

Abstract

Adi-Harush Refugee Camp is located in the North West of Tigray regional state of Ethiopia, at about 1170 km from the capital Addis Ababa.

The camp population is 9766 [UNHCR, July, 2017]. The camp hosts Eritrean refugees having different ethnic groups where the majorities are Tigrigna and Saho and some minorities of Tigre and Belian.

The main objective of this survey was to collect data and information on water, sanitation, and coverage in the Adi-Harush Refugee camp in 2017 and to have base line data for the 2018 interventions. The total sample size was 175 households.

The study revealed the gravity of the identified problems, which are latrine coverage, safe water management at home level, hand washing practice, and the risk of diarrhea disease.

Geographic coverage

Adi-Harush camp, Shire

Analysis unit

Household

Sampling procedure

The survey was conducted by systematic random sampling method in which all of the households in the refugee camp have same chance to be selected. Since the camp is divided into five zones, the sample sizes to be collected per zone was determined using the sample proportional to the population size. The sampling interval of a zone was determined using total household of the zone divided by the number of samples to be collected from that zone.

Mode of data collection

Face-to-face [f2f]

Research instrument

The survey questionnaire used to collect the data consists of the following sections: general information and demographics, water collection and storage, drinking water hygiene, hygiene, sanitation, messaging, distribution, diarrhoea prevalence and health seeking behaviour.

Cleaning operations

Data was anonymized through decoding and local suppression.

Abstract

Hitsats Refugee Camp is located in the Tigray regional state of Ethiopia, at about 1092 km from the capital, Addis Ababa.
The camp population is 10,361 (December, 2017 UNHCR). The camp hosts Eritrean refugees having different ethnic groups where the majorities are Tigrigna and Saho and some minorities of Tigre and Belian.
Hitsats refugee camp was opened in May 2013 and the International Rescue Committee Ethiopia Environmental Health program has been working in the camp since May 5, 2013 with core mandate to provide safe water and sanitation services. The Environmental Health (EH) program is designed with the main objective of preventing mortality and morbidity due to diarrhea and other water borne diseases. The knowledge, attitude and practice (KPC) survey was conducted in December 2017 to serve as an end line survey for 2017 and as a baseline survey for 2018. 171 households were interviewed. Objective of the survey was to assess the improvements and gaps in knowledge, practice and coverage of Hitsats refugee community in relation to water, sanitation and hygiene promotion. In general the study revealed the gravity of the identified problems, which focuses on latrine, water, hand washing practice, solid waste management and the risk of diarrhea disease.

Geographic coverage

Hitsats camp, Shire

Analysis unit

Household

Sampling procedure

The survey was conducted with a systematic random sampling method in which all of the households in the refugee camp have same chance to be selected. Since the camp is divided into zones, the sample size to be collected per zone was determined using the sample proportional to the population size. The sampling interval of a zone was determined dividing the total number of households in the zone by number of samples to be collected in that zone. The instrument used for data collection was a structured pre-tested questionnaire using an application on smartphone.

Mode of data collection

Face-to-face [f2f]

Research instrument

The survey questionnaire used to collect the data consists of the following sections: General Information and Demographics, Water Collection and Storage, Drinking Water Hygiene, Hygiene, Sanitation, Messaging, Distribution, Diarrhoea Prevalence and Health Seeking Behaviour.

Cleaning operations

Data was anonymized through decoding and local suppression.

Supplementary documents for the manuscript titled: A Case-Control Study of Racial Differences in Melasma Risk Factors and Incidence in a Diverse National United States Population for publication through JAAD.

Abstract

As part of a comprehensive research agenda that includes both market and behavioral research, NetMark conducts periodic household surveys on ITN-related topics in selected countries. The survey provides quantitative information useful to the public health community as well as to the commercial sector. It covers: - Awareness and ownership of mosquito nets and ITNs - Use of nets and treated nets by vulnerable groups - Net treatment practices - Characteristics of nets owned - Knowledge and beliefs about mosquitoes and malaria; exposure to information about ITNs - Perceptions of treated and untreated mosquito nets - Consumer preferences regarding mosquito nets - Use of other mosquito control products

Geographic coverage

The survey conducted in the following areas/ regions of the country: Bahir Dar, Nazret, Dire Dawa, Dessie and Awassal.

Analysis unit

Household

Kind of data

Sample survey data [ssd]

Sampling procedure

Plan abd Procedure The sample was composed of 1000 Ethiopian households. Respondents were women of reproductive age (15-49) who were mothers or guardians of children under five years of age.

In the interest of comparability, the same procedure was used in all countries surveyed. A multistage sampling procedure was used to select respondents, as follows.

1- Selection of primary sampling units: Purposive sampling was used to select the five primary sites: Bahir Dar, Nazret, Dire Dawa, Dessie and Awassa. Only sites in malarious areas were selected. In all other countries surveyed, the capital city was included; however, since malaria is not a significant problem in Addis Ababa, the capital was not included for the Ethiopia survey. Further criteria included geo-ethnic diversity and the potential for NetMark to be active in product distribution and/or programs to provide targeted subsidies for vulnerable groups. In each site, the target sample was 200: 80 respondents from the urban center, and 120 households from up to 200 kilometers from the urban center. Therefore, the sample has an urban-rural ratio of 40:60. The sample is proportionately more urban than that of the country as a whole. The 1994 census was 14% urban and the Demographic and Health Survey of 2000 was 26% urban.

2- Selection of sampling points: Within each of the five sites, 20 sampling points (villages or urban neighborhoods) were randomly selected from electoral lists using quota sampling: 8 from within the city (urban) and 12 from within 200 kilometer radius from the city (rural). Ten households per sampling point were selected for inclusion. This stratification scheme was designed to meet the purposes of the evaluation. Since a key objective of NetMark is to increase ownership of ITNs across the socio-economic spectrum, it was essential to include urban centers with the potential to be reached by product distribution systems, as well as include households located at varying distances from the urban center where lower socio-economic status (SES) individuals typically reside.

3- Selection of households: Ten interviews were conducted per sampling point, each in a different household. For each sampling point, a starting point (a fixed landmark or address) and the direction from which to start the data collection were chosen. Interviewers were instructed to go to the starting point and walk in the chosen direction until they located a residence with a qualified respondent. After a successful interview, interviewers were instructed to skip five residences (or less if residences were far apart) and seek another qualified respondent.

4- Selection of eligible respondents: An eligible respondent for the evaluation was a female 15-49 years old who was the parent or guardian of a child less than five years old, i.e., aged 0-4. Females aged 15-49 were selected to maximize the sample size for calculating the proportion of females of reproductive age sleeping under a net. Similarly, only those women who had a child under five were included, to maximize the sample size for calculating the proportion of children under five sleeping under a net.

Mode of data collection

Face-to-face [f2f]