The U.S. National Fungus Collections (BPI) are the “Smithsonian for fungi” and are the repository for over one million fungal specimens worldwide - the largest such collections in the world. The collection includes preserved organisms, their parts and products, and their associated data. Information associated with these specimens constitute an enormous data resource, especially about plant-associated fungi. The collections document fungi through time and space for the past 200 years. Data from the labels of more than 750,000 of the specimens have been entered into a database. These labels have information on the host on which the fungus was found and the locality in which the specimen was collected. Sixty percent of these specimens are from the United States and thus represent a large body of information about the fungi in this country. Data entry has been completed for the Uredinales (rusts), the Ustilaginales (smuts), the Polyporales (polypores), the Deuteromycetes (imperfect fungi), the Ascomycetes, and the C.G. Lloyd collections. Recent progress has been made in the computerization of specimens of the agarics and the "lower" fungi including the Oomycetes and Chytridiomycetes. Resources in this dataset:Resource Title: Fungal databases - Specimens. File Name: Web Page, url: https://nt.ars-grin.gov/fungaldatabases/specimens/specimens.cfm The direct database form link

The USDA-ARS U.S. National Fungus Collections (BPI) currently houses approximately one-million reference specimens. Data associated with over 925,000 specimens have been computerized and are available on-line. In addition reports of fungi on plants provide a comprehensive account of the host range and geographic distribution of fungi on plants throughout the world. Data are continuously added to the databases from herbarium specimens and newly published fungus-host distributions and disease reports. Additional databases contain taxonomic literature references and accurate scientific names of plant pathogenic fungi.

A dataset containing the contents of the US National Fungus Collections Fungus-Host-Location database with citations. Searchable version available at https://nt.ars-grin.gov/fungaldatabases. Dataset current as of 2021 Nov. 05. Resources in this dataset:Resource Title: United States National Fungus Collections Fungus-Host Dataset. File Name: Fungus-Host-Data_20211105.csvResource Description: Snapshot of Fungus-Host-Location-Reference dataset as of 2021 Nov. 05.Resource Software Recommended: Microsoft Excel 365,url: https://www.microsoft.com/en-us/microsoft-365/microsoft-office

This website contains a list of five fungal genome databases from The J. Craig Venter Institute. Aspergillus genomes: -Aspergillus fumigatus (strain-Af 293) -Aspergillus clavatus -Neosartorya fischeri Other Fungal Genomes: -Cryptococcus neoformans (strain-JEC21) -Coccidioides posadasii

This database and mapping tool was produced to allow the identification of sites important to this incredibly diverse range of grassland fungal species for which Scotland is important on a global scale. Promotion of this project could lead to a great amount of these vulnerable sites being managed for their waxcaps, leading directly to the conservation of biodiversity, including several species on the Scottish Biodiversity List.Included layers:Heatmap of grassland fungi to the 10km level. The fewest species per square is represented by the lightest colour and the highest species per square represented by darkest colour. ADVICE: This layer is ideal for giving an overview of records in the area, but it doesn’t mean the fungi are throughout the area, or that the whole area is unimproved grassland.Heatmap of grassland fungi to the 1km level. The fewest species per square is represented by the lightest colour and the highest species per square represented by darkest colour. ADVICE: 1km grid square layer may provide a false picture and a blank square does not necessarily mean that no grassland fungi are there. Accurate georeferencing of biological records before the age of GPS and specialist phone apps was rare with many blocks of records being given the same centroid grid reference. Also, it would be common for many recorders to record the first find of a species on a site and none thereafter. THE 10KM SQUARE SHOULD BE LOOKED AT ALONGSIDE THIS LAYER.Point layer showing the Waxcap Sites. Sites are based centroid grid references for a spread of records in the area. The sites do not have clear boundaries, and so some form of local habitat knowledge is needed to set actual site boundaries within the real-world boundaries of unimproved grassland.• RED: Any site passing any of the SSSI thresholds• AMBER: Any site not passing any of the SSSI thresholds but with more than 11 species of Hygrocybe s.l. or with more than 4 IUCN species or with more than 4 indicator species.• GREEN: Any other site that has records of grassland fungi.Complete metadata on spatialdata.gov.scot.Data was collected from data holders from January to July 2023This database uses SSSI lists from 2018 JNCC guidelinesThis database uses a 2013 Bolete Fungi Red ListTaxonomy choices are correct in 2023See report for full referencesThis database has collated records of grassland species from the various fungus record holding institutions, ‘cleaned’ them, classified ‘sites’, and then rates sites and grid squares their mycological diversity using both the SSSI guidelines and the CHEGD grassland fungi rating system to allow judgements on their richness. There is also data on other fungal features such as phenology, and the presence of Red Listed species. With the information in this database, sites that qualify for fungal SSSI designation can be identified, and tools such as interactive maps made to allow land users to recognise sites of importance.The database of information and the GIS layers were created by the contractor David Mitchel. This contractor has also made Grassland fungi databases for statutory nature organisations in Ireland, N. Ireland, Wales, and England, and the databases are intercompatible.The data was collected from a variety of recording groups, individuals and biological record centres. These sources can be found in the Research Report RR1372

This database contains a manually curated set of human, animal and plant pathogens, annotated with their confirmed host range and relevant sources. In addition to that, we include additional sets of plant-associated fungi (which may include non-pathogens), as well as fungi with an automatically assigned, putative human, animal or plant host. The labelled fungal species are linked to their representative GenBank genomes wherever possible. Genomes that were screened, but no label was found, are also included. [Last update on: 11 Dec 2022] [Home page: https://dacs-hpi.gitlab.io/pathogenic-fungi/] The database is stored in a flat-file format. All metadata are stored in all_data_[date].csv, and all_data_[date].rds contains the same data in a compressed format that can be easily loaded in R. The database was first compiled on 9 Oct 2021 (v1.0), and then updated on 2 Jan 2022 (v1.1) and 11 Dec 2022 (v1.2). The core database is limited to manually confirmed human, animal and plant pathogens with available genomes as of 9 Oct 2021. Those data are a subset of all_data, and are stored in core_fungal_pathogens.csv and core_fungal_pathogens.rds. The temporal-test subset contains confirmed pathogens with genomes added to GenBank between 9 Oct 2021 and 2 Jan 2022. You may also be interested in trained neural network models predicting pathogenic potentials of novel fungi from DNA sequences (https://zenodo.org/record/5711877) and simulated Illumina read sets used to train them (https://zenodo.org/record/5846397). See also the preprint: https://www.biorxiv.org/content/10.1101/2021.11.30.470625 and the paper presented at ECCB '22 and published in Bioinformatics: https://doi.org/10.1093/bioinformatics/btac495.

Database containing observations of fungi and Mycetozoa mainly from Denmark. New observations are continuously added through the registration portal http://svampe.databasen.org, which was developed as part of the "Danmarks Svampeatlas" project. The project is a collaboration between the Natural History Museum of Denmark and Department of Biology, University of Copenhagen, the Danish Mycological Society and MycoKey. The project received generous financial support from Aage V. Jensen Naturfond. The aim of Svampeatlas is to compile all Basidiomycota from Denmark and to increase the knowledge of fungal distribution and ecology in Denmark, by making this information publicly available. With more than 400 active users contributing to the project, there has been more than 325.000 finds with a total of about 2.500 species of Basidiomycota. In addition a similar number of older finds has been imported from various published sources, persona and project databases.

fungi (true fungi [mushrooms, lichens, moulds, yeast], chromistan fungi [downy mildews, water moulds], protozoan fungi [slime moulds and their allies])

This resource contains records from Slovenian Fungal Database - Boletus informaticus on 31th March 2008. The resource represents the collected data on the species and distribution of fungi in Slovenia from the archives of the Mycological Association of Slovenia and the personal archives of its members, as well as, in part, from existing collections and literature sources. A computer program for inputting data on fungi in Slovenia is called Boletus informaticus. The program is aimed at systematically recording species of fungi, their distribution, and data regarding their habitat, in addition the program allows various ways processing materials, various means of data retrieval, and cartographical presentations of finds. When the related monograph (Dušan Jurc, Andrej Piltaver, Nikica Ogris. 2005. Fungi of Slovenia: species and distribution. Studia forestalia Slovenica, 124, Ljubljana, Slovenian Forestry Institute: 497 p.) was published in 2005, there were 114,620 records that describe distribution of 2,452 species of fungi in Slovenia. On 31th March 2008 the BI database had 160,757 records. These records give distribution to 2763 fungi species. All mentioned records are published here.

UNITE is a rDNA sequence database designed to provide a stable and reliable platform for sequence-borne identification of all fungal species. UNITE provides a unified way for delimiting, identifying, communicating, and working with DNA-based Species Hypotheses (SH). All fungal ITS sequences in the International Nucleotide Sequence Databases (INSD: GenBank, ENA, DDBJ) are clustered to approximately the species level by applying a set of dynamic distance values (0.5 - 3.0%). All species hypotheses are given a unique, stable name in the form of a DOI, and their taxonomic and ecological annotations are verified through distributed, web-based third-party annotation efforts. SHs are connected to a taxon name and its classification as far as possible (phylum, class, order, etc.) by taking into account identifications for all sequences in the SH. An automatically or manually designated sequence is chosen to represent each such SH. These sequences are released (https://unite.ut.ee/repository.php) for use by the scientific community in, for example, local sequence similarity searches and next-generation sequencing analysis pipelines. The system and the data are updated automatically as the number of public fungal ITS sequences grows.

Fungal and arthropod consumers constitute the vast majority of global terrestrial biodiversity. Yet, the link from richness and composition of producer (plant) communities to the richness of consumer communities is poorly understood. Fungal and arthropod species richness could be a simple function of producer species richness at a site. Alternatively, it could be a complex function of chemical and structural properties of the producer species making up communities. We used databases on plant-fungus and plant-arthropod trophic links to derive the richness of consumer biota per associated plant species (coined link score). We assessed how well link scores could be predicted by simple attributes of plant species. Next, we used a multi-taxon inventory of 130 sites, representing all major habitat types in a country (Denmark), to investigate whether link scores summed over plant species in communities (coined link sum) could outperform simple plant species richness as predictor of fungal and ...

The dataset representing a compilation of species lists from published literature on fungal diversity of peatlands globally. Totally 127 literature sources were found, digitized and information on fungal occurrences was extracted in the dataset. About 20% of the published works used cultivation technique (summing in about 1000 records in the dataset), while 80% represent direct observation of fruiting structures of larger fungi or micro-fungi (totally about 4700 records in the dataset). The table has 15 fields, including scientificName, habitat (vegetation type), occurrenceRemarks (substrate or other field notes), bibliographicCitation, eventDate, country, and locality. The taxonomic structure of fungal diversity represented by the dataset (after synonimization using GBIF species matching tool) includes 3 kingdoms (Fungi, Chromista, Protozoa), 7 phyla, 27 classes, 87 orders, 239 families, 616 genera and about 1500 species. The larger fungi represent about 80% of occurrences and 1100 species, while microfungi only about 400 species.

NOTE: Due to security issues, the ARSEF database search function is not currently available and we are transitioning to a site on the ARS-AZURE cloud. Please contact the curator (Kathryn.Bushley@usda.gov) if you need information about specific groups or a custom search of the database that can be sent via e-mail. Printed PDF catalogues of all isolates and other information about the collection are available on the ARSEF website at https://www.ars.usda.gov/northeast-area/ithaca-ny/robert-w-holley-center-for-agriculture-health/emerging-pests-and-pathogens-research/docs/mycology/ The Agricultural Research Service Collection of Entomopathogenic Fungal Cultures is the world's largest, most kaleidoscopic, and most comprehensive collection of living cultures of fungi that are pathogenic to or associated with insects, spiders, mites, ticks, and other invertebrates. Some isolates in the collection are not themselves invertebrate pathogens but are critically important for the improvements of taxonomies and systematics for the many diverse groups of fungi represented here. As of July 2016, ARSEF maintains more than 13000 isolates of more than 700 taxa of fungi isolated from 1300 hosts collected at more than 2400 locations on every continent. The database is searchable by Fungi, Hosts, Locations, Provenance, or Accessions. Results are provided in PDF format. Catalog files are in the Adobe Acrobat (PDF) format and are readable with the Adobe Acrobat Reader. All catalogs and live searches of isolate data incorporate the most current supportable taxonomies for ARSEF fungi. Significant changes in the nomenclatural rules for many fungi have a large and ongoing impact on the entomopathogens in the order Hypocreales. These changes are discussed the introductory material in the catalogs. If you are unsure about the most current identifications for isolates, online searches of ARSEF accessions return taxonomic information in the collection database at the moment of the search.

• Incompleteness of reference sequence databases and unresolved taxonomic relationships complicates taxonomic placement of fungal sequences. We developed PROTAX-fungi, a general tool for taxonomic placement of fungal ITS sequences, and implemented it into the PlutoF platform of the UNITE database for molecular identification of fungi. • PROTAX-fungi outperformed the SINTAX and RDB classifiers in terms of increased accuracy and decreased calibration error when applied to data on mock communities representing species groups with poor sequence database coverage. • With empirical data on root- and wood-associated fungi, PROTAX-fungi identified reliably (with at least 90% identification probability) the majority of sequences to the order level but only ca. one fifth of them to the species level, reflecting the current limited coverage of the databases. • When applied to examine the internal consistencies of the Index Fungorum and UNITE databases, PROTAX-fungi revealed inconsistencies in the ...

This database is supplementary material of the article "Diversity of Brazilian Fungi" published in the Journal Rodriguésia in 2015 (DOI: 10.1590 / 2175-7860201566407).

This is a protein fasta dataset for use with diamond. The fasta.gz file contains protein sequences for the following:

• 1,164 genomes downloaded from JGI (taxonomy_taxids.tsv)
• 121 genomes that are part of the taxmapper database (taxmapper_taxonomy_taxids.tsv) of which 6 were fungal
• the Hygrophorus russula MG78 genome downloaded from NCBI.

For the H. russula genome, genes were predicted using Augustus (v. 3.2.3) with the laccaria_bicolor model.

The final protein database consists of a total of 17,694,143 protein sequences (14,976,193 from JGI, 2,708,401 from taxmapper and 9,549 from H. russula).

The fasta file and associated taxonomic information files (nodes.dmp.gz & taxonmap.gz) can be used to build a diamond database compatible with diamond version 0.9.22:

zcat fasta.gz | diamond makedb -d diamond --taxonmap taxonmap.gz --taxonnodes nodes.dmp

The MIPS Ustilago maydis Genome Database aims to present information on the molecular structure and functional network of the entirely sequenced, filamentous fungus Ustilago maydis. The underlying sequence is the initial release of the high quality draft sequence of the Broad Institute. The goal of the MIPS database is to provide a comprehensive genome database in the Genome Research Environment in parallel with other fungal genomes to enable in depth fungal comparative analysis. The specific aims are to: 1. Generate and assemble Whole Genome Shotgun sequence reads yielding 10X coverage of the U. maydis genome 2. Integrate the genomic sequence assembly with physical maps generated by Bayer CropScience 3. Perform automated annotation of the sequence assembly 4. Align the strain 521 assembly with the FB1 assembly provided by Exelixis 5. Release the sequence assembly and results of our annotation and analysis to public Ustilago maydis is a basidiomycete fungal pathogen of maize and teosinte. The genome size is approximately 20 Mb. The fungus induces tumors on host plants and forms masses of diploid teliospores. These spores germinate and form haploid meiotic products that can be propagated in culture as yeast-like cells. Haploid strains of opposite mating type fuse and form a filamentous, dikaryotic cell type that invades plant tissue to reinitiate infection. Ustilago maydis is an important model system for studying pathogen-host interactions and has been studied for more than 100 years by plant pathologists. Molecular genetic research with U. maydis focuses on recombination, the role of mating in pathogenesis, and signaling pathways that influence virulence. Recently, the fungus has emerged as an excellent experimental model for the molecular genetic analysis of phytopathogenesis, particularly in the characterization of infection-specific morphogenesis in response to signals from host plants. Ustilago maydis also serves as an important model for other basidiomycete plant pathogens that are more difficult to work with in the laboratory, such as the rust and bunt fungi. Genomic sequence of U. maydis will also be valuable for comparative analysis of other fungal genomes, especially with respect to understanding the host range of fungal phytopathogens. The analysis of U. maydis would provide a framework for studying the hundreds of other Ustilago species that attack important crops, such as barley, wheat, sorghum, and sugarcane. Comparisons would also be possible with other basidiomycete fungi, such as the important human pathogen C. neoformans. Commercially, U. maydis is an excellent model for the discovery of antifungal drugs. In addition, maize tumors caused by U. maydis are prized in Hispanic cuisine and there is interest in improving commercial production. The complete putative gene set of the Broad Institute''s second release is loaded into the database and in addition all deviating putative genes from a putative gene set produced by MIPS with different gene prediction parameters are also loaded. The complete dataset will then be analysed, gene predictions will be manually corrected due to combined information derived from different gene prediction algorithms and, more important, protein and EST comparisons. Gene prediction will be restricted to ORFs larger than 50 codons; smaller ORFs will be included only if similarities to other proteins or EST matches confirm their existence or if a coding region was postulated by all prediction programs used. The resulting proteins will be annotated. They will be classified according to the MIPS classification catalogue receiving appropriate descriptions. All proteins with a known, characterized homolog will be automatically assigned to functional categories using the MIPS functional catalog. All extracted proteins are in addition automatically analysed and annotated by the PEDANT suite.

A relational database with dynamic querying and data integration that can be used by researchers to identify genetic sequences with a high probability of being associated with aflatoxin accumulation resistance, according to multiple lines of evidence. CFRAS-DB integrates genomic, proteomic, and genetic data from multiple studies in maize dealing with aflatoxin accumulation or Aspergillus flavus resistance.

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name: Fungal_ITS gITS7/ITS4 Gene: FITS Length of Target: 150-330 get_seeds_local() minimum length: 105 get_seeds_local() maximum length: 500 blast_seeds() minimum length: 65 blast_seeds() maximum length: 461 max_to_blast: 100 Forward Sequence (5'-3'): GTGARTCATCGARTCTTTG Reverse Sequence (5'-3'): TCCTCCGCTTATTGATATGC Reference: White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, 18(1), 315–322. Ihrmark, K., Bödeker, I., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., Strid, Y., Stenlid, J., Brandström-Durling, M., & Clemmensen, K. E. (2012). New primers to amplify the fungal ITS2 region–evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiology Ecology, 82(3), 666–677. https://doi.org/10.1111/j.1574-6941.2012.01437.x

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

The Index Fungorum, the global fungal nomenclator coordinated and supported by the Index Fungorum Partnership, contains names of fungi (including yeasts, lichens, chromistan fungi, protozoan fungi and fossil forms) at species level and below. Funding from GBIF (2003-2004) under the ECAT work programme enabled the addition of most missing author citations and year of publication and the linking of most homotypic names. New names from the Index of Fungi, compiled at CABI-UK and published by CABI, are added every three months. The Bibliography of Systematic Mycology provides a survey of the literature encompassing the biodiversity, classification, distribution, evolution, identification, nomenclature, phylogeny, systematics and taxonomy of fungi (as defined in the previous paragraph). You can search the database using the index of cited generic names or author names. The Dictionary of the Fungi (currently 10th edition, 2008) published by CABI also contains the current consensus on the fungal taxonomic hierarchy to the rank of genus. Here you can search the database for the status of generic names, or walk down the hierarchy from the rank of Kingdom. The entries for each genus generally include authors and place of publication together with the type species (linked to Index Fungorum) and other data. A database of family names which includes authors, place of publication and type genus (linked to the Dictionary of the Fungi hierarchy) is now supplemented by one which contains names at all supra-familial ranks although it is far from completion. CABI Bioscience is presently coordinating the fungal component of the Species 2000 project and its contribution, in partnership with ITIS, to the Catalogue of Life (currently used in the GBIF portal); for more information regarding this global initiative visit their website. You may search here a small but growing number of taxonomically complete datasets - global species databases. Please contact Paul Kirk if you you would like to contribute. All these databases need to be improved and updated in terms of data content. Please contact Paul Kirk if you have any additions or suggested changes (which will be acknowledged). The database structures have been developed by Jerry Cooper and Paul Kirk and the web interface by Jerry Cooper. Please contact Jerry Cooper if you have any problems with pages or database searches.