This is a view service of the CEH 1:50k rivers dataset. This is a river centreline network, based originally on OS 1:50,000 mapping. There are four layer: rivers; canals; surface pipes (man-made channels such as aqueducts and leats) and miscellaneous channels (including estuary and lake centre-lines and some underground channels).The dataset was produced within a long-term project of the Institute of Hydrology (now CEH) between the mid-1970s and the late 1990s. The project digitised, (either manually or using 'laser scanners') the "blue line" layer of the Ordnance Survey's 1:50,000 2nd series (Landranger) maps. The dataset consists of all the single blue lines from the source maps, plus centre-lines from double sided rivers, lakes and estuaries. All gaps in the source material have been closed, using local knowledge where necessary, to give a river network that is continuous from source to mouth

This dataset comprises river centrelines, digitised from OS 1:50,000 mapping. It consists of four components: rivers; canals; surface pipes (man-made channels for transporting water such as aqueducts and leats); and miscellaneous channels (including estuary and lake centre-lines and some underground channels). This dataset is a representation of the river network in Great Britain as a set of line segments, i.e. it does not comprise a geometric network.

Statutory Main Rivers Map is a spatial (polyline) dataset that defines statutory watercourses in England designated as Main Rivers by the Environment Agency.

Watercourses designated as ‘main river’ are generally the larger arterial watercourses. The Environment Agency has permissive powers, but not a duty, to carry out maintenance, improvement or construction work on designated main rivers.

All other open water courses in England are determined by statute as an ‘ordinary watercourse’. On these watercourses the Lead Local flood Authority or, if within an Internal Drainage District, the Internal Drainage Board have similar permissive powers to maintain and improve.

This is a collection of simple maps in PDF format that are designed to be printed off and used in the classroom. The include maps of Great Britain that show the location of major rivers, cities and mountains as well as maps of continents and the World. There is very little information on the maps to allow teachers to download them and add their own content to fit with their lesson plans. Customise one print out then photocopy them for your lesson. data not available yet, holding data set (7th August). Other. This dataset was first accessioned in the EDINA ShareGeo Open repository on 2012-08-07 and migrated to Edinburgh DataShare on 2017-02-22.

This web map service provides a 1km resolution gridded coverage of wooded areas in riparian zones (river- or streamsides) across Great Britain. The areas classified as riparian in this dataset are defined by a 50 metre buffer applied to the CEH 1:50000 watercourse network. Wooded areas within this zone are identified as those classified by the Land Cover Map of Great Britain 2007 as either coniferous or deciduous woodland. The data are aggregated to a 1km resolution.

Web Map containing Statutory Main River Map, Statutory Main River Map Variations 2022 and Statutory Main River Variations pre 2021 feature layers.Created for use by Web Mapping Application: Main River Map

Data shows the location of Priority Habitat Chalk rivers and Streams. Replaces the existing 1:50,000 scale data.Based on Environment Agency Detailed River Network (DRN) version 3. All fields from DRN have been retained. This subset of chalk rivers uses the old 1:50,000 Biodiversity Action Plan (BAP) chalk river data, BGS geology, WWF report "The State of England’s Chalk Streams" and stakeholder knowledge to produce an updated chalk river network for England.Full metadata can be viewed on data.gov.uk (to follow).

The Statutory Main River Map Variations dataset defines proposed changes to the Statutory Main River Map.

Statutory Main Rivers Map defines statutory watercourses in England designated as Main Rivers by Environment Agency.

Watercourses designated as ‘main river’ are generally the larger arterial watercourses. The Environment Agency has permissive powers, but not a duty, to carry out maintenance, improvement or construction work on designated main rivers.

All other open water courses in England are determined by statute as an ‘ordinary watercourse’. On these watercourses the Lead Local flood Authority or, if within an Internal Drainage District, the Internal Drainage Board have similar permissive powers to maintain and improve.

The Environment Agency notifies the public and interested parties of our intentions to make a change to the statutory main river map and decides which watercourses are designated as Main Rivers following a legal process to determine and publish changes.

The change, or variation, to the Statutory Main River Map is either a deletion (also known as a demainment) or an addition (also known as an enmainment).

There are two reasons for a change to the Statutory Main River Map - Designation and Factual.

Designation changes are required when we make a decision to lengthen or shorten the section of a river designated as a 'main river'. These changes will determine which risk management authority may carry out maintenance, improvement or construction work on the watercourse. These changes result also in differing legislation applying to the riparian owner and others with an interest.

Factual changes may be required to update the map to represent the real position of the watercourse. They do not involve any changes of authority or management. Typical examples of factual changes are when: a watercourse has changed course naturally, a watercourse has been diverted or a survey of a culvert shows a different alignment.

A change to the Statutory Main River Map goes through the following stages (identified as Status within the data):

• Draft
• Consultation
• Pending Determination
• Determination
• Appeals
• Pending Appeals
• Pending Implementation
• Implemented (Month and Year)

Watercourses which have been designated as ‘main’ are generally the larger arterial watercourses. The Environment Agency has permissive powers, but not a duty, to carry out maintenance, improvement or construction work on designated main rivers.

The Flood Map for Planning (Rivers and Sea) includes several layers of information. This layer and documentation covers Flood Zone 2. It is the Environment Agency's best estimate of the areas of land at risk of flooding, when he presence of flood defences are ignored and covers land between Zone 3 and the extent of the flooding from rivers or the sea with a 1 in 1000 (0.1%) chance of flooding each year. This dataset also includes those areas defined in Flood Zone 3.This dataset is designed to support flood risk assessments in line with Planning Practice Guidance ; and raise awareness of the likelihood of flooding to encourage people living and working in areas prone to flooding to find out more and take appropriate action. This dataset is republished by the West of England Combined Authority for supplementing information within our Local Nature Recovery Strategy. If you are using it for statutory purposes, you should refer to the Environment Agency's canonical version, linked in the Attributions field below as this is likely to be more current.

PLEASE NOTE: This dataset has been retired. It has been superseded by https://environment.data.gov.uk/dataset/04532375-a198-476e-985e-0579a0a11b47.The Flood Map for Planning (Rivers and Sea) includes several layers of information. This dataset covers Flood Zone 2 and should not be used without Flood Zone 3. It is our best estimate of the areas of land at risk of flooding, when the presence of flood defences are ignored and covers land between Zone 3 and the extent of the flooding from rivers or the sea with a 1 in 1000 (0.1%) chance of flooding each year. This dataset also includes those areas defined in Flood Zone 3.This dataset is designed to support flood risk assessments in line with Planning Practice Guidance ; and raise awareness of the likelihood of flooding to encourage people living and working in areas prone to flooding to find out more and take appropriate action.The information provided is largely based on modelled data and is therefore indicative rather than specific. Locations may also be at risk from other sources of flooding, such as high groundwater levels, overland run off from heavy rain, or failure of infrastructure such as sewers and storm drains.The information indicates the flood risk to areas of land and is not sufficiently detailed to show whether an individual property is at risk of flooding, therefore properties may not always face the same chance of flooding as the areas that surround them. This is because we do not hold details about properties and their floor levels. Information on flood depth, speed or volume of flow is not included.NOTE: We have paused quarterly updates of this dataset. Please visit the “Pause to Updates of Flood Risk Maps” announcement on our support pages for further information. We will provide notifications on the Flood Map for Planning website to indicate where we have new flood risk information. Other data related to the Flood Map for Planning will continue to be updated, including data relating to flood history, flood defences, and water storage areas.

OS Open Rivers GIS data contains over 144,000 km of water bodies and watercourses map data. These include freshwater rivers, tidal estuaries and canals.

Understand how water bodies and watercourses in Great Britain join up.

OS Open Rivers provides a comprehensive datset of Great Britain's River Network, which approximately indicates the central alignment of the watercourse. Inland and tidal rivers are represented by a series of connected link and node features which are assigned with river name and flow direction.

OS Open Rivers is a generalised open water network showing the flow and the locations of rivers, streams, lakes and canals across the whole of Great Britain. The new product is part of the OS Open suite and is designed to be used with other OpenData product sets. It’s mapping that can help you question, visualise and share results quickly and clearly. With OS Open Rivers you can: Understand the water network at a ‘high level’ with generalised geometry and network connectivity.View a network of main rivers, identifying the main river course along its full length.Pin information on the connected network for personal or business use. Take an informed overview of a situation along the network to manage it strategically. Compare and monitor stretches of water. Share information, such as flood alerts and flood risk areas.The currency of this data is 10/2024 The coverage of the map service is GB. The map projection is British National Grid.

"One of the two datasets that make up the Priority River Habitat Map. Consists of rivers and streams that exhibit a high degree of naturalness. The naturalness classification used to map priority river habitat is based on recent work to review the river SSSI series. It evaluates four main components of habitat integrity: hydrological, physical, physico-chemical (water quality) and biological. An additional classification of the naturalness of headwaters (defined as streams with a catchment area of <10km2 to coincide with WFD typology boundaries) uses land cover data as a surrogate for direct information on river habitat condition (information which is generally lacking on headwaters). Streams and rivers operating under natural processes, free from anthropogenic impact and with a characteristic and dynamic mosaic of small-scale habitats that supports characteristic species assemblages (including priority species), are the best and most sustainable expression of river ecosystems. Key elements are: a natural flow regime; natural nutrient and sediment delivery regimes; minimal physical modifications to the channel, banks and riparian zone; natural longitudinal and lateral hydrological and biological connectivity; an absence of non-native species; low intensity fishery activities. These conditions provide the best defence against climate change, maximising the ability of riverine ecosystems to adapt to changing conditions. They also provide the most valuable and effective transitional links with other priority habitats, including lakes, mires and coastal habitats. In English rivers and streams, high levels of naturalness are rare. "

Location of manmade barriers, mostly weirs, and natural features, such as waterfalls, on river courses in England and Wales. This dataset is known as 'Potential Sites of Hydropower Opportunity' and has been created under the EA project 'Opportunity and environmental sensitivity mapping for hydropower in England and Wales'. The dataset shows the location of opportunities for hydropower and the basic environmental sensitivity, which considers the presence of fish species and whether the site has been designated as Special Area of Conservation (SAC), associated with exploiting them. Besides their location, the dataset includes information on river level height, up and downstream the barrier.

This dataset consists of an interactive map (and supporting guidance) containing background information that informs how we understand flood risk across the Severn River Basin District. The map shows the River Basin District, component river basins and the coastline together with layers showing land use and topography.

This dataset together with equivalent datasets for each River Basin District, supports the Preliminary Flood Risk Assessment for England report which has been written to meet the requirements of the Flood Risk Regulations (2009) - to complete an assessment of flood risk and produce supporting maps of river catchments.

Large-scale, accurate and fully attributed digital river centreline covering England and Wales. The dataset has full-feature network geometry cross-referenced with OS MasterMap following Digital National Framework principles. The dataset has full-feature network geometry cross-referenced with OS MasterMap following Digital National Framework. It is made of the three following layers: - Links: lines representing the river network. It is a river centreline dataset, based on OS MasterMap for surface features and Environment Agency culvert surveys for underground features (where available). There are many attributes associated with this dataset to enable it to be used for many different business purposes. It is topologically correct to allow it's use in network tracing tasks. - Offline Drainage: lines representing the sections of river and drains that do not obviously connect to the main online drainage network represented by the DRN. Sections with uncertain flow direction and connectivity are presented here, although in reality some may connect to the main DRN, and be added to it as more information becomes available. - Nodes: points representing the junctions between discrete stretches of the online DRN. It is used to assist in connectivity and flow direction, as every DRN stretch is attributed with the 'from' and 'to' nodes. Nodes are also included where line features cross, but do not intersect, such as an aqueduct passing over a river. Nodes have types to determine whether they are at for example junction or at a change in river type.

Eurasian otters are apex predators of freshwater ecosystems and a recovering species across much of their European range; investigating the dietary variation of this predator over time and space therefore provides opportunities to identify changes in freshwater trophic interactions and factors influencing the conservation of otter populations. Here we sampled faeces from 300 dead otters across England and Wales between 2007 and 2016, conducting both morphological analysis of prey remains and dietary DNA metabarcoding. Comparison of these methods showed that greater taxonomic resolution and breadth could be achieved using DNA metabarcoding but combining data from both methodologies gave the most comprehensive dietary description. All otter demographics exploited a broad range of taxa and variation likely reflected changes in prey distributions and availability across the landscape. This study provides novel insights into the trophic generalism and adaptability of otters across Britain, which is likely to have aided their recent population recovery, and may increase their resilience to future environmental changes. Methods Sample and data collection Samples and associated metadata were acquired from 300 otters collected between 2007 and 2016, obtained from the Cardiff University Otter Project, a national monitoring programme for dead otters sampled from across Great Britain (https://www.cardiff.ac.uk/otter-project). Most otters collected were killed by road traffic accidents, with a minority dying through drowning, being shot, starvation, or disease. Information on date (year and month) and location (as grid reference) of carcass collection were recorded at the site of collection. Grid references were used to plot data for spatial analysis. Detailed post-mortems were performed for each carcass during which biotic data were obtained (e.g., sex and size of individual). Faecal samples were collected from the rectum during post-mortem examination, wrapped in foil and stored at -20 °C. Following post-mortems, scaled mass index (SMI) was calculated for each individual otter using the following equation (Peig and Green 2009; Peig and Green 2010): SMI = Mi [ L0 / Li ] bSMA Mi is the body mass and Li is the length measurement of individual i, L0 is the mean length measurement for the entire study population and bSMA is the scaling exponent. Length was measured from nose to tail-tip to the nearest 5 mm. Mean length and the scaling exponent were both calculated from all otter data available as of January 2017 (n = 2477). The scaling exponent is the slope from the standard major axis regression of log-transformed values of mass against length.Otters were also classified into size categories based on their total length (nose to tail tip) using the ‘bins’ function in R (OneR v2.2 package; von Jouanne-Diedrich 2017), which applies a clustering method using Jenks natural breaks optimisation. Male and female otters were clustered separately into small (males <1046 mm, females <936 mm long), medium (males between 1046 mm and 1131 mm, females between 936 mm and 1031 mm), and large (males > 1131 mm, females > 1031 mm). Spatial data Spatial data describing proximity to the coast, urban land use, altitude, slope, and primary water habitat were collated using QGIS version 3.4.4 (QGIS Development Team 2019). Distance from the coast was calculated as the shortest distance (km) along a river from the location at which the otter was found to the low tide point of the mouth of the river (hereafter referred to as ‘river distance’), using the package RivEX (Hornby 2020), because otters tend to travel along water courses rather than across land. As most otters were found as roadkill, and not all were adjacent to rivers, each otter was first assigned to the nearest river. Locations more than 1000 m from a river were checked, and if there was more than one river along which the otter might have travelled, then river distance was calculated for all rivers and a mean distance used. All otters within 1000 m of the coast were given a distance of zero if they were closer to the coastline than a river.Otter locations were mapped as points, and circular areas of 10 km diameter (hereafter referred to as ‘buffers’) mapped around each. Faecal samples typically reflect diet from the preceding 24-72 hours (in mammals; Deagle et al. 2005; Casper et al. 2007; Thalinger et al. 2016), during which time otters can travel up to 10 km (Chanin 2003), it was therefore deemed appropriate to use this distance to reflect the land used by otters within the sample timeframe. Buffers were used to calculate proportions of urban land-use (i.e., urban and suburban land use extracted from the 25 m resolution UK land cover map from 2007; Morton et al. 2011), mean altitude and mean slope (extracted from European Digital Elevation Model (EU-DEM) map; European Environment Agency 2011). We chose to focus on urban land-use as urbanisation may affect otter diet either through changes to prey assemblages or disturbance affecting an otter's ability to forage. Longitude, altitude, and slope were highly correlated, therefore longitude was used in further analyses as a representative for the three variables.Otters in England and Wales typically feed in freshwater river systems but will opportunistically feed in lakes or at the coast if these habitats are within range (Jędrzejewska et al. 2001; Clavero et al. 2004; Parry et al. 2011). Available prey differ between lakes, coasts, and river systems, as well as between different parts of the river network (e.g., tributary, main river channel). To assess whether water habitat type influenced dietary variation, we designated each otter to one of the following: transitional water (coastal and estuarine), lake, main river channel, or tributary (based on Water Framework Directive 2000/60/EC designations mapped using GIS shapefiles provided by Natural Resources Wales and Environment Agency). Otters within 2.5 km (half of a buffer’s radius) from a lake or transitional water were assigned to that habitat, whilst those further away were assumed to be feeding primarily in the river network. The RivEX network map (Hornby 2020) was used to map all rivers, and individuals were further categorised according to whether their assumed habitat was primarily a main river or tributary. To do this, the total length of main river channels and tributaries was calculated within each 10 km buffer. The length of main channels was weighted 10 times greater to account for the greater cross-section of a main channel compared to tributaries (Benda et al. 2004) since waterways with greater areas are assumed to support more prey (Samarasin et al. 2014). The sum of weighted main river lengths and tributary lengths was calculated, and if more than 50 percent of each buffer was attributed to main river channel, the otter was assigned to the main river channel, otherwise it was assigned to tributary. Morphological analysis Each faecal sample was first thawed, homogenised by hand in a sterile container, and divided into subsamples; three samples weighing 200 mg each were collected for DNA analysis (one sample used for DNA extraction and the other two frozen as back-ups) and the remaining material was used for morphological analysis. Subsamples undergoing morphological analysis were then soaked in a solution of water and liquid biological detergent (water:detergent, 10:1) for 24 hours. Samples were passed through sieves with a 0.5 mm mesh and washed with water to ensure only hard parts remained which were air-dried for 24 hours. A record was made of any samples that did not contain any hard parts. Recognisable remains (bones, fish scales, feathers, fur) underwent microscopic identification using a range of keys (Libois and Hallet-Libois 1987; Coburn and Gaglione 1992; Prenda and Granado-Lorencio 1992; Prenda et al. 1997; Watt et al. 1997; Miranda and Escala 2002; Conroy et al. 2005; Tercerie et al. 2019; University of Nottingham 2020). Prey remains were identified to the finest possible taxonomic resolution and recorded as present within or absent from a sample. DNA metabarcoding analysis Faecal samples were processed for HTS, and subsequent bioinformatic analysis was conducted, as described in Drake et al. (2022). In summary, DNA was extracted from a subsample of faecal material and amplified using two metabarcoding primer pairs, designed to amplify regions of the 16S rRNA and cytochrome c oxidase subunit I (COI) genes, each primer having 10 base pair molecular identifier tags (MID tags) to facilitate post-bioinformatic sample identification.Two primer sets from different barcoding regions were selected to overcome biases associated with each region and broaden the range of taxa amplified: the 16S barcoding region selected for vertebrate DNA, and cytochrome c oxidase subunit I (COI) for invertebrate DNA. For 16S, the novel primer pair FN2199 (5’- yayaagacgagaagaccct -3’) and R8B7 (5’- ttatccctrgggtarcthgg -3’; modified for this study from Deagle et al. 2009) were used, which targeted a 225-267 bp amplicon (including primers). For COI, the primer pair Mod_mCOIintF (5’- ggwacwggwtgaacwgtwtaycc -3’; modified for this study from Leray et al. 2013) and HCO-2198 (5’- taaacttcagggtgaccaaaaaatca -3’; Folmer et al. 1994) were used, which targeted a 365 bp amplicon (including primers). Primers underwent in silico testing using ecoPCR (Boyer et al. 2016) and were further tested in vitro. In silico and vitro tests showed primer sets amplified desired taxa. COI primers were also found to amplify a range of vertebrate taxa but did not cover the same range as the 16S primers, therefore justifying the use of both primer sets beyond the benefit of different primer pairs exhibiting different biases.Faecal samples were processed alongside extraction and PCR negative controls, repeat samples, and mock communities, which comprised standardised mixtures of DNA of

This dataset is published as Open DataWhat OS Open Rivers provides you withSolve challengesModel simple what-if scenarios. OS Open Rivers lets you answer questions like ‘which rivers would be affected by a toxic discharge from this site?’Water quality dataFor sharing water quality data, this is ideal. OS Open Rivers lets you tag information with the river IDs used by environment agencies so everybody can use it.Comprehensive map dataOS Open Rivers GIS data contains over 144,000 km of water bodies and watercourses map data. These include freshwater rivers, tidal estuaries and canals.

PLEASE NOTE: This dataset has now been retired. It was last updated on 02/11/2022 and has been replaced by the Spatial Flood Defences (inc. standardised attributes) dataset. This is a more comprehensive dataset of assets, comes with attribution and is updated daily. See: https://environment.data.gov.uk/dataset/8e5be50f-d465-11e4-ba9a-f0def148f590

The Flood Map for Planning (Rivers and Sea) shows the areas across England that could be affected by flooding from rivers or the sea. It also shows flood defences and the areas that benefit from them.

The Flood Map is designed to raise awareness among the public local authorities and other organisations of the likelihood of flooding and to encourage people living and working in areas prone to flooding to find out more and take appropriate action.

The Flood Map includes several layers of information, this dataset is: Spatial Flood Defences (without standardised attributes), which shows those defences constructed which have a standard of protection equal to or better than 1 in 100 (1%) for rivers and 1 in 200 (0.5%) from the sea. (Some additional defences are also shown). Attribution Statement: © Environment Agency copyright and/or database right 2018. All rights reserved.Some features of this map are based on digital spatial data from the Centre for Ecology & Hydrology, © NERC (CEH). © Crown copyright and database rights 2018 Ordnance Survey 100024198