The National Health Related Items Code (NHRIC) is a system for identification and numbering of marketed device packages that is compatible with other numbering systems such as the National Drug Code (NDC) or Universal Product Code (UPC). Those manufacturers who desire to use the NHRIC number for unique product identification may apply to FDA for a labeler code. This database contains NHRIC data retrieved from records that date back 20 years.

rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.

Primer Name: MiFish Universal
Gene: 12S
Length of Target: 163–185
get_seeds_local() minimum length: 170
get_seeds_local() maximum length: 250
blast_seeds() minimum length: 140
blast_seeds() maximum length: 250
max_to_blast: 1000
Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC
Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG
Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

The Drug Listing Act of 1972 requires registered drug establishments to provide the Food and Drug Administration (FDA) with a current list of all drugs manufactured, prepared, propagated, compounded, or processed by it for commercial distribution. (See Section 510 of the Federal Food, Drug, and Cosmetic Act (Act) (21 U.S.C. � 360)). Drug products are identified and reported using a unique, three-segment number, called the National Drug Code (NDC), which serves as a universal product identifier for drugs. FDA publishes the listed NDC numbers and the information submitted as part of the listing information in the NDC Directory which is updated daily.

This dataset represents the list of CA WIC authorized food items identified by food category and subcategory. Each item is uniquely identified by a Universal Product Code (UPC) or Price Look-Up code (PLU) for WIC electronic benefit transfer (EBT). The WIC Authorized vendors use the CA Authorized Product List (APL) to transact WIC food items at cash registers. The APL plays a crucial role in supporting WIC EBT purchases. WIC EBT requires vendor systems to maintain the APL to match the scanned food items' UPCs to ensure they are on the APL. The food items identified by UPC and PLU can be found in the data files below. When you download the files, Excel may prompt you to automatically format the data. If prompted, you may want to hit ‘Don’t Convert’ so that Excel leaves the data as is without any formatting or data conversions.

The Women, Infants and Children (WIC) Program is a federally-funded health and nutrition program that provides assistance to pregnant women, new mothers, infants, and children under age five. WIC helps California families by providing food benefits to individual participants based on their nutritional need and risk assessment. The food benefits can be used to purchase healthy supplemental foods from approximately 3,800 WIC authorized vendor stores throughout the State. WIC also provides nutritional education, breastfeeding support, healthcare referrals, and other community services. Participants must meet income guidelines and other criteria. Currently, 84 WIC agencies provide services monthly to approximately one million participants at several hundred sites in local communities throughout the State.

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name: MiFish Universal
Gene: 12S
Length of Target: 163–185
get_seeds_local() minimum length: 170
get_seeds_local() maximum length: 250
blast_seeds() minimum length: 140
blast_seeds() maximum length: 250
max_to_blast: 1000
Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC
Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG
Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

Explore the historical Whois records related to upc-barcode.com (Domain). Get insights into ownership history and changes over time.

Explore the historical Whois records related to cheap-upc-barcode.com (Domain). Get insights into ownership history and changes over time.

Subscribers can find out export and import data of 23 countries by HS code or product’s name. This demo is helpful for market analysis.