The PDS Universal Planetary Coordinates (UPC) Database, Mars DB

The Product Barcode Database is an exhaustive repository of barcodes for a vast array of products across over 60K eCommerce categories. This offering is indispensable for retailers and logistic companies requiring accurate and swift product identification. It includes UPCs, EANs, ASINs, eBay item IDs, Walmart Item IDs, and their inter-conversions, ensuring broad compatibility and utility across eCommerce platforms.

Popular Attributes:

✔ Comprehensive barcode repository

✔ Includes UPCs, EANs, ASINs, and more

✔ Conversion between barcode types

✔ Ideal for product tracking and logistics, and sending full product feeds to advertising platforms like Google Merchant Center

✔ Cross-platform compatibility

Key Information:

Over 2B+ Records with extensive barcode data

Pricing: Various licensing options

Update Frequency: Regular updates

Coverage: Global

Historical Data: 12 Months+

What is the Universal Planetary Coordinates (UPC)? The Universal Planetary Coordinates (or UPC) is a database of many of the level 1 imaging data products archived in the PDS Imaging Node. The UPC includes the camera statistics, URLs for thumbnail and browse images, and the GIS footprint for each image. These data products and meta data are calculated using ISIS3. For this reason, only data products which have an ISIS3 camera model can be included in the UPC.

UPC Uploads from manufactures for recycling

Diatoms (Bacillariophyta) are ubiquitous microalgae which produce a siliceous exoskeleton and which make a major contribution to the productivity of oceans and freshwaters. They display a huge diversity, which makes them excellent ecological indicators of aquatic ecosystems, and can also be used to reconstruct paleoenvironments. Usually, diatoms are identified using characteristics of their exoskeleton morphology, which can be time consuming and error-prone. DNA-barcoding is an alternative to this and the use of High-Throughput-Sequencing enables the rapid analysis of many environmental samples at a lower cost than if specialist analysts are used. However, to identify environmental sequences correctly, an expertly curated reference library is needed. Several curated libraries for protists exists; none, however, are dedicated to diatoms. Diat.barcode is an open-access library dedicated to diatoms which has been maintained since 2012. It was initiated with the barcoding network of INRA (French National Institute for Agricultural Research) R-Syst, is now an international initiative partly supported by a Cost network (DNAqua-net). Data come from two sources (1) the NCBI nucleotide database (National Center for Biotechnology Information) and (2) unpublished sequencing data of culture collections in France, UK and Russia. Since 2017, several European experts have collaborated to curate this library for rbcL, a chloroplast marker suitable for species-level identification of diatoms. For the latests versions of the database, more than 8100 curated barcodes are available. The database is accessible through https://www6.inra.fr/carrtel-collection_eng/Barcoding-database. A ready-to-use subset of the database for metabarcoding analyses is also accessible.

This database was produced within the CHIL Project (Computers in the Human Interaction Loop), in the framework of an Integrated Project (IP 506909) under the European Commission's Sixth Framework Programme. It contains a set of isolated acoustic events that occur in a meeting room environment and that were recorded for the CHIL Acoustic Event Detection (AED) task. The recorded sounds do not have temporal overlapping. The database can be used as training material for AED technologies as well as for testing AED algorithms in quiet environments without temporal sound overlapping.The database contains signals corresponding to 23 audio channels with corresponding labels (out of 84 channels used in the whole CHIL task). The 23 audio channels correspond to: 12 microphones of the 3 T-shaped clusters, 4 tabletop omni directional microphones, and 7 channels of the Mark III array.Data was recorded at 44.1kHz, 24-bit precision, and then converted to 16-bit Raw Little Endian format. All the channels were synchronized. During all recordings two-three additional people were inside the room for a more realistic scenario.Approximately 60 sounds per sound class were recorded. Each session was produced by the same ten people (5 men and 5 women). There are 3 sessions per participant. At each session, the participant took a different place in the room out of 7 fixed different positions. During each session a person had to produce a complete set of sounds twice. A script indicating the order of events to be produced was given to each participant. Almost each event was followed and preceded by a pause of several seconds. All sounds were produced individually, except “applause” and several “laugh” that were produced by the people that were inside the room altogether. The annotation was done manually.The database is stored on 3 DVDs (one session per DVD). The following table summarizes the content of the DVDs and shows the number of annotated acoustic events in each session:

This dataset contains 917 specimen records of 179 chironomid species between 1989 and 2015 in Japan, which are based on the Chironomid DNA Barcode Database published by National Institute for Environmental Studies, Japan (NIES). The Chironomid DNA Barcode Database can be found at https://www.nies.go.jp/yusurika/en/index.html.

This dataset contains 50 specimen records of 1 suborder, 4 family, 2 subfamily, 6 genus and 4 species of insects and freshwater animals in Ogasawara Islands, Japan between 2003 and 2017 published by National Institute for Environmental Studies, Japan (NIES). The Ogasawara DNA barcode database can be found at https://www.nies.go.jp/ogasawara/.

rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.

Primer Name: MiFish Universal
Gene: 12S
Length of Target: 163–185
get_seeds_local() minimum length: 170
get_seeds_local() maximum length: 250
blast_seeds() minimum length: 140
blast_seeds() maximum length: 250
max_to_blast: 1000
Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC
Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG
Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

The Barcode of Life Data System (BOLD) is an informatics workbench aiding the acquisition, storage, analysis and publication of DNA barcode records. CSIRO Marine and Atmospheric Research (CMAR) …Show full descriptionThe Barcode of Life Data System (BOLD) is an informatics workbench aiding the acquisition, storage, analysis and publication of DNA barcode records. CSIRO Marine and Atmospheric Research (CMAR) contributes to this database, as of May 2008, it has contributed about 1000 species of fish, mostly from multiple samples, along with ~100 species of decapods and ~100 species of echinoderms (marine invertebrates). There is DNA data for a specific gene (COI). The collection of data includes GPS location, date, depth, who collected and identified sample, and some have photos. The samples used in providing the information to the Database from CMAR are housed at the Marine Laboratories in Hobart.

This database is an adaptation for DADA2 of Diat.barcode v9. Length of sequences is 263 bp ------------------------- Rimet, Frederic; Chonova, Teofana; Gassiole, Gilles; Gusev, Evgenuy; Kahlert, Maria; Keck, François; Kelly, Martyn; Kulikovskiy, Maxim; Maltsev, Yevhen; Mann, David; Pfannkuchen, Martin; Trobajo, Rosa; Vasselon, Valentin; Wetzel, Carlos; Zimmermann, Jonas; Bouchez, Agnès, 2018, "Diat.barcode, an open-access barcode library for diatoms", https://doi.org/10.15454/TOMBYZ

A list of all UPC codes and corresponding model numbers provided by partners for ENERGY STAR certified products. The brand, model name and model number continue to serve as the identifiers used to establish certification. The UPC code data below is intended to aid in identification of ENERGY STAR models. UPC code data is not provided for all certified models.

Explore the historical Whois records related to upc-barcode.com (Domain). Get insights into ownership history and changes over time.

The dataset contains 203 records of Diptera species collected from 2014 to 2018 in continental Portugal (Ferreira et al., 2020). The species represented in the dataset, 154 in total, correspond to about 10% of the known fly diversity of continental Portugal, and contribute to the knowledge on the DNA barcodes and distribution of Portuguese Diptera. Specimens were captured during fieldwork directed specifically for the sampling of Diptera using different methodologies and stored in 96% ethanol. All specimens were morphologically identified to species level. A tissue sample, usually a leg, was collected from each individual, from which DNA was extracted. The DNA barcoding of these specimens was conducted within the InBIO Barcoding Initiative (IBI), funded by EnvMetaGen and PORBIOTA projects. DNA barcode sequences were deposited in BOLD (Barcode of Life Data System) online database. Preserved specimens and DNA extracts are deposited in the IBI collection at the CIBIO (Research Center in Biodiversity and Genetic Resources).

Benthic surveys are comprised of three components, all sampled along the same transects: (1) uniform point contact (UPC) estimates of benthic cover and substrate characteristics, (2) swath transects to estimate the density of kelps and macroinvertebrates and (3) quadrat sampling to estimate the density of recruits of selected invert species, small invertebrates, cyrptic fishes and recruit macroalgae. This metadata record documents the uniform point contact (UPC) surveys for PISCO subtidal benthic community surveys. UPC sampling consists of recording the substrate type, physical relief and percent cover of non-mobile invertebrates and algae along 30m long transects. Subtidal community structure surveys are conducted annually at all sites during the summer or early fall, and quantify substrate type and relief, benthic cover, abundance of major groups of macroalgae and invertebrates, and abundance and size of fishes. Spatial allocation of sampling is designed to measure year-to-year site-wide variability in community structure and the spatial scales at which such variation occurs. A site is defined as a fixed stretch of coastline, occupying approximately 500m. Originally, each site was divided into 2 halves (sides), each comprised of 12 transects stratified across the four zones described above. Starting in 2007, many new sites were added for monitoring MPAs established by the MLPA along the coast of central California. These MLPA sites are equivalent of one "side" of the orignal PISCO sites (i.e. 12 transects).

Barcode Data Capture System Market Outlook

The global Barcode Data Capture System market size was valued at $9.5 billion in 2023 and is projected to reach $15.8 billion by 2032, growing at a compound annual growth rate (CAGR) of 5.6% during the forecast period. This substantial growth is driven by the increasing adoption of barcode technology across various industries for inventory management, asset tracking, and point-of-sale systems, among other applications. The rise in automation and the need for efficient data capture methods in both large enterprises and small and medium enterprises (SMEs) are significant factors contributing to the marketÂ’s expansion.

The primary growth driver for the Barcode Data Capture System market is the rapid expansion of the e-commerce and retail sectors. With the proliferation of online shopping, there is a heightened need for efficient inventory management and quick turnaround times in order processing, both of which rely heavily on barcode data capture systems. Retailers are increasingly adopting these systems to streamline their operations, reduce errors, and improve customer satisfaction. Additionally, advancements in barcode technology, such as the development of QR codes and 2D barcodes, provide more robust and reliable data capture solutions, further propelling market growth.

Another critical growth factor is the increasing adoption of barcode systems in the healthcare sector. Hospitals, clinics, and other healthcare facilities use barcode data capture systems to track patient information, manage medical inventory, and ensure the correct administration of medication. This not only enhances operational efficiency but also significantly reduces the likelihood of human error, thereby improving patient safety. The growing emphasis on patient safety and the need for accurate medical records are expected to drive the adoption of barcode systems in healthcare settings, contributing to market growth.

The manufacturing and transportation industries are also key contributors to the growth of the barcode data capture system market. In manufacturing, barcodes are used for tracking raw materials, work-in-progress, and finished goods, which helps in maintaining accurate inventory levels and achieving efficient production processes. In transportation and logistics, barcodes facilitate the tracking and tracing of shipments, ensuring timely delivery and reducing the risk of lost or misplaced items. The increasing need for supply chain visibility and the demand for real-time data are driving the adoption of barcode systems in these industries.

Barcode Verification plays a crucial role in ensuring the accuracy and reliability of barcode data capture systems. As businesses increasingly rely on barcodes for inventory management, product tracking, and point-of-sale transactions, the need for precise and error-free data capture becomes paramount. Barcode verification involves checking the quality and readability of barcodes to prevent scanning errors and data discrepancies. This process helps in maintaining data integrity across various applications and industries. By implementing robust barcode verification processes, organizations can enhance operational efficiency, reduce manual errors, and improve overall customer satisfaction. As the demand for flawless data capture solutions grows, barcode verification will continue to be an essential component of the barcode data capture system market.

From a regional perspective, North America holds a significant share of the barcode data capture system market due to the high adoption rate of advanced technologies and the presence of major market players. The Asia Pacific region is expected to exhibit the highest growth rate during the forecast period, driven by the rapid industrialization, growing e-commerce sector, and increasing investments in the retail and healthcare industries. Europe also represents a substantial market share, supported by the strong presence of automotive and manufacturing industries that extensively use barcode systems for various applications.

Component Analysis

The Barcode Data Capture System market can be segmented by component into hardware, software, and services. The hardware segment includes barcode scanners, printers, and mobile computers, which are essential tools for capturing and printing barcodes. This segment i

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name: MiSebastes
Gene: CytB
Length of Target: 153
get_seeds_local() minimum length: 107
get_seeds_local() maximum length: 199
blast_seeds() minimum length: 71
blast_seeds() maximum length: 163
max_to_blast: 100
Forward Sequence (5'-3'): AAGCTCATTCAAGTGCTT
Reverse Sequence (5'-3'): GACCACTTACACAATTCT
Reference: Min, M. A., Barber, P. H., & Gold, Z. (2021). MiSebastes: An eDNA metabarcoding primer set for rockfishes (genus Sebastes). Conservation Genetics Resources, 13(4), 447-456. https://doi.org/10.1007/s12686-021-01219-2

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

Total numbers of vascular plant taxa that were observed across 35 soil cores with eDNA and overlap with the list of previously recorded taxa, given the database coverage.

In a rapidly changing world we need methods to efficiently assess biodiversity in order to monitor ecosystem trends. Ecological monitoring often uses plant community composition to infer quality of sites but conventional aboveground surveys only capture a snapshot of the actively growing plant diversity. Environmental DNA (eDNA) extracted from soil samples, however, can include taxa represented by both active and dormant tissues, seeds, pollen, and detritus. Analysis of this eDNA through DNA metabarcoding provides a more comprehensive view of plant diversity at a site from a single assessment but it is not clear which DNA markers are best used to capture this diversity. Sequence recovery, annotation, and sequence resolution among taxa were evaluated for four established DNA markers (matK, rbcL, ITS2, and the trnL P6 loop) in silico using database sequences and in situ using high throughput sequencing of 35 soil samples from a remote boreal wetland. Overall, ITS2 and rbcL are recommended for DNA metabarcoding of vascular plants from eDNA when not using customized or geographically restricted reference databases. We describe a new framework for evaluating DNA metabarcodes and, contrary to existing assumptions, we found that full length DNA barcode regions could outperform shorter markers for surveying plant diversity from soil samples. By using current DNA barcoding markers rbcL and ITS2 for plant metabarcoding, we can take advantage of existing resources such as the growing DNA barcode database. Our work establishes the value of standard DNA barcodes for soil plant eDNA analysis in ecological investigations and biomonitoring programs and supports the collaborative development of DNA barcoding and metabarcoding.

Gain in-depth insights into Barcode Data Capture System Market Report from Market Research Intellect, valued at USD 4.2 billion in 2024, and projected to grow to USD 8.1 billion by 2033 with a CAGR of 8.1% from 2026 to 2033.